PortEco logo

aaeX:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

aaeX

Mnemonic

Aromatic (carboxylic) acid efflux

Synonyms

ECK3231, b3242, JW5541, yhcR[1], yhcR

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

73 minutes 

MG1655: 3387359..3387156


REL606

NC_012967: 3317031..3317234


BW2952

NC_012759: 3274304..3274507


W3110

 

W3110: 3389192..3388989


DH10B

DH10B: 3485104..3484901


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔaaeX (Keio:JW5541)

deletion

deletion

PMID:16738554[2]

Shigen


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW5541

Plasmid clone

Shigen

PMID:16769691[3]

Status:Clone OK

Primer 1:GCCAGTCTGTTTCCCGTTATCGT

Primer 2:CCAACGAACAGTCGCGATATCAA

3G9

Kohara Phage

Genobase

PMID:3038334[4]

21D3

Kohara Phage

Genobase

PMID:3038334[4]

zhc-6::Tn10

Linked marker

CAG12153 = CGSC7442[5]

est. P1 cotransduction: 42% [6]
Synonyms:zha-6::Tn10

acrF3083::Tn10

Linked marker

CAG12075 = CGSC7447[5]

est. P1 cotransduction: 35% [6]
Synonyms:zhd-3083::Tn10, zhe-3083::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G7687

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG12824

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120004234

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:947751

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2675

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0010636

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  3. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  4. 4.0 4.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  5. 5.0 5.1 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories