PortEco logo

abgT:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

abgT

Mnemonic

Aminobenzoyl-glutamate

Synonyms

ECK1332, b1336, JW5822, ydaH[1], ydaH

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

30.14 minutes 

MG1655: 1399797..1398271


REL606

NC_012967: 1398943..1397417


BW2952

NC_012759: 1290330..1291856


W3110

 

W3110: 1403487..1401961


DH10B

DH10B: 1489193..1487667


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔabgT (Keio:JW5822)

deletion

deletion

PMID:16738554[2]

Shigen

ydaH::Tn5KAN-I-SceI (FB20297)

Insertion at nt 305 in Minus orientation

PMID:15262929[3]

E. coli Genome Project:FB20297

contains pKD46

ΔydaH::kan

deletion

Biolog:respiration

unable to respire Acetate

PMID:16095938[4]


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW5822

Plasmid clone

Shigen

PMID:16769691[5]

Status:Clone OK

Primer 1:GCCAGTATGTCATCCATACCGTC

Primer 2:CCAGACAAACGTGGGTAAATACC

6B4

Kohara Phage

Genobase

PMID:3038334[6]

3G3

Kohara Phage

Genobase

PMID:3038334[6]

zcj-233::Tn10

Linked marker

CAG12028 = CGSC7373[7]

est. P1 cotransduction: 32% [8]
Synonyms:zci-233::Tn10

recT3061::Tn10

Linked marker

CAG12081 = CGSC7375[7]

est. P1 cotransduction: 66% [8]
Synonyms:zcj-3061::Tn10, zda-3061::Tn10

pMJH128

Plasmid Clone

plasmid carrying abgT restores the p-aminobenzoyl-glutamate untilization phenotype of the abg::kan strain [9]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG12853

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG12853

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002401

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945912

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2697

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0004488

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  3. Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  4. Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed EcoliWiki page
  5. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  6. 6.0 6.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  7. 7.0 7.1 CGSC: The Coli Genetics Stock Center
  8. 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  9. Hussein, MJ et al. (1998) Characterization of mutations that allow p-aminobenzoyl-glutamate utilization by Escherichia coli. J. Bacteriol. 180 6260-8 PubMed EcoliWiki page

Categories