PortEco logo

accA:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

accA

Mnemonic

Acetyl-CoA carboxylase

Synonyms

ECK0184, b0185, JW0180[1], JW0180

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

4.5 minutes 

MG1655: 208621..209580


REL606

NC_012967: 211463..212422


BW2952

NC_012759: 208620..209579


W3110

 

W3110: 208621..209580


DH10B

DH10B: 182725..183684


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

208624

Edman degradation

PMID:1355089[2]
PMID:9298646[3]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

accA ++

Overexpression

Increase Acetyle COA Carboxylase activity upon over expression.

PMID:10893421[4]

See Table 1.

Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0180

Plasmid clone

Shigen

PMID:16769691[5]

Status:Clone OK

Primer 1:GCCAGTCTGAATTTCCTTGATTT

Primer 2:CCCGCGTAACCGTAGCTCATCAG

E2B8

Kohara Phage

Genobase

PMID:3038334[6]

6F5

Kohara Phage

Genobase

PMID:3038334[6]

10F9

Kohara Phage

Genobase

PMID:3038334[6]

zad-220::Tn10

Linked marker

CAG12025 = CGSC7326[7]

est. P1 cotransduction: 4% [8]

yafC502::Tn10

Linked marker

CAG18436 = CGSC7328[7]

est. P1 cotransduction: 42% [8]
Synonyms:zae-502::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11647

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11647

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001591

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:944895

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1600

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0000630

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Li, SJ & Cronan, JE Jr (1992) The genes encoding the two carboxyltransferase subunits of Escherichia coli acetyl-CoA carboxylase. J. Biol. Chem. 267 16841-7 PubMed EcoliWiki page
  3. Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed EcoliWiki page
  4. Davis, MS et al. (2000) Overproduction of acetyl-CoA carboxylase activity increases the rate of fatty acid biosynthesis in Escherichia coli. J. Biol. Chem. 275 28593-8 PubMed EcoliWiki page
  5. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  6. 6.0 6.1 6.2 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  7. 7.0 7.1 CGSC: The Coli Genetics Stock Center
  8. 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories