PortEco logo

accD:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

accD

Mnemonic

Acetyl-CoA carboxylase

Synonyms

ECK2310, b2316, JW2313, dedB[1], dedB, usg

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

BW2952

NC_012759: 2316839..2317753


MG1655

52.4 minutes, 52.4 minutes 

MG1655: 2431948..2431034


REL606

NC_012967: 2377518..2376604


W3110

 

W3110: 2439372..2438458


DH10B

DH10B: 2523713..2522799


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

accD6(ts)

Growth Phenotype

temperature sensitive

PMID:4564200[2] PMID:4597230[3] PMID:1355086[4]

CGSC:64607

at 37C normal growth can be restored

accD ++

Overexpression

Increase Acetyle COA Carboxylase activity upon over expression.

PMID:10893421[5]

See Table 1.

Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2313

Plasmid clone

Shigen

PMID:16769691[6]

Status:Clone OK

Primer 1:GCCAGCTGGATTGAACGAATTAA

Primer 2:CCGGCCTCAGGTTCCTGATCCGG

9D2

Kohara Phage

Genobase

PMID:3038334[7]

12F12

Kohara Phage

Genobase

PMID:3038334[7]

zfb-223::Tn10

Linked marker

CAG18484 = CGSC7406[8]

est. P1 cotransduction: 17% [9]
Synonyms:zej-223::Tn10

zfd-1::Tn10

Linked marker

CAG18467 = CGSC7408[8]

est. P1 cotransduction: 4% [9]
Synonyms:zfb-1::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10217

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10217

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000211

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:946796

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0213

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0007648

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Harder, ME et al. (1972) Temperature-sensitive mutants of Escherichia coli requiring saturated and unsaturated fatty acids for growth: isolation and properties. Proc. Natl. Acad. Sci. U.S.A. 69 3105-9 PubMed EcoliWiki page
  3. Silbert, DF et al. (1974) Proceedings: Genetic engineering of membrane lipid. Fed. Proc. 33 1725-32 PubMed EcoliWiki page
  4. Li, SJ et al. (1992) The dedB (usg) open reading frame of Escherichia coli encodes a subunit of acetyl-coenzyme A carboxylase. J. Bacteriol. 174 5755-7 PubMed EcoliWiki page
  5. Davis, MS et al. (2000) Overproduction of acetyl-CoA carboxylase activity increases the rate of fatty acid biosynthesis in Escherichia coli. J. Biol. Chem. 275 28593-8 PubMed EcoliWiki page
  6. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  7. 7.0 7.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  8. 8.0 8.1 CGSC: The Coli Genetics Stock Center
  9. 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories