PortEco logo

aceE:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

aceE

Mnemonic

Acetate

Synonyms

ECK0113, b0114, JW0110[1], JW0110

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

2.65 minutes 

MG1655: 123017..125680


REL606

NC_012967: 125821..128484


BW2952

NC_012759: 123016..125679


W3110

 

W3110: 123017..125680


DH10B

DH10B: 97121..99784


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

123020

Edman degradation

PMID:9298646[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

aceE(del) (Keio:JW0110)

deletion

deletion

Auxotrophies

PMID:16738554[3]

Shigen

CGSC8392[4]

aceE(del)::kan

deletion

Biolog:respiration

unable to respire a-Ketobutyrate

PMID:16095938[5]

aceE(del)::kan

deletion

Biolog:respiration

unable to respire Succinate

PMID:16095938[5]

aceE(del)::kan

deletion

Biolog:respiration

unable to respire Bromosuccinate

PMID:16095938[5]

aceE(del)::kan

deletion

Biolog:respiration

unable to respire L-Alanine

PMID:16095938[5]

aceE(del)::kan

deletion

Biolog:respiration

unable to respire L-Alanyl-glycine

PMID:16095938[5]

aceE(del)::kan

deletion

Biolog:respiration

unable to respire L-Asparagine

PMID:16095938[5]

aceE(del)::kan

deletion

Biolog:respiration

unable to respire L-Aspartate

PMID:16095938[5]

aceE(del)::kan

deletion

Biolog:respiration

unable to respire L-Serine

PMID:16095938[5]

aceE64

Auxotrophies

CGSC:5645

aceE2

Auxotrophies

CGSC:8124

aceE732(del)::kan

Auxotrophies

PMID:16738554[3]

CGSC:99886


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0110

Plasmid clone

Shigen

PMID:16769691[6]

Status:Clone OK

Primer 1:GCCTCAGAACGTTTCCCAAATGA

Primer 2:CCCGCCAGACGCGGGTTAACTTT

4D12

Kohara Phage

Genobase

PMID:3038334[7]

4E11

Kohara Phage

Genobase

PMID:3038334[7]

leuO3051::Tn10

Linked marker

CAG12095 = CGSC7324[4]

est. P1 cotransduction: 19% [8]
Synonyms:zab-3051::Tn10 nnnThe start of leuO was reannotated by Riley et al. (2006).

zad-220::Tn10

Linked marker

CAG12025 = CGSC7326[4]

est. P1 cotransduction: 38% [8]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10024

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10024

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000021

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:944834

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0023

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0000397

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed EcoliWiki page
  3. 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. 5.0 5.1 5.2 5.3 5.4 5.5 5.6 5.7 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed EcoliWiki page
  6. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  7. 7.0 7.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  8. 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories