PortEco logo

aceK:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

aceK

Mnemonic

Acetate

Synonyms

ECK4008, b4016, JW3976[1], JW3976

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

BW2952

NC_012759: 4106299..4108035


MG1655

90.88 minutes 

MG1655: 4216619..4218355


REL606

NC_012967: 4198139..4199875


W3110

 

W3110: 4222186..4223922


DH10B

DH10B: 4316315..4318051


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

4216622

Edman degradation

PMID:2836370[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

aceKK336M

K336M

Auxotrophies

Inhibits enzyme

seeded from UniProt:P11071

aceKD371A,E,Q

D371A,E,Q

Auxotrophies

Loss of activity

seeded from UniProt:P11071

aceKN377A

N377A

Auxotrophies

No loss of activity

seeded from UniProt:P11071

aceKD403A

D403A

Auxotrophies

No loss of activity

seeded from UniProt:P11071

aceKE439A

E439A

Auxotrophies

No loss of activity

seeded from UniProt:P11071

ΔaceK (Keio:JW3976)

deletion

deletion

Auxotrophies

PMID:16738554[3]

Shigen

CGSC10859[4]

ΔaceK783::kan

deletion

deletion

Auxotrophies

PMID:16738554[3]

CGSC:99890


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW3976

Plasmid clone

Shigen

PMID:16769691[5]

Status:Clone OK

Primer 1:GCCCCGCGTGGCCTGGAATTATT

Primer 2:CCAAAAAGCATCTCCCCATACCG

6G10

Kohara Phage

Genobase

PMID:3038334[6]

thiC39::Tn10

Linked marker

CAG18500 = CGSC7472[4]

est. P1 cotransduction: 44% [7]
Synonyms:thi-39::Tn10

malF3089::Tn10

Linked marker

CAG12164 = CGSC7476[4]

est. P1 cotransduction: 41% [7]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10026

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10026

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000023

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:944797

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0025

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0013131

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Klumpp, DJ et al. (1988) Nucleotide sequence of aceK, the gene encoding isocitrate dehydrogenase kinase/phosphatase. J. Bacteriol. 170 2763-9 PubMed EcoliWiki page
  3. 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  6. Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  7. 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories