E. coli is indeed the coolest thing on the planet - Carl Zimmer
acnB:Gene
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
| Standard name |
acnB |
|---|---|
| Mnemonic | |
| Synonyms |
ECK0117, b0118, JW0114, yacI, yacJ[1] |
| edit table | |
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Notes
Location(s) and DNA Sequence
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
2.84 minutes |
MG1655: 131615..134212 | ||
|
W3110 |
|
W3110: 131615..134212 | ||
| edit table |
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Notes
Sequence Features
| Feature type | Location | Description |
|---|---|---|
| edit table |
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Notes
Alleles and Phenotypes
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔacnB (Keio:JW0114) |
deletion |
deletion | |||||
|
∆acnB::tetR |
Internal deletion of acnB replaced with tetR gene. |
Growth Phenotype |
Cannot grow on acetate as the sole carbon and energy source with or without supplementation with glutamate. | ||||
|
∆acnB::tetR |
Internal deletion of acnB substituted with tetR. |
Growth Phenotype |
Grows poorly on minimal glucose medium unless the medium is supplemented with glutamate. The same phenotype is seen for growth on minimal medium with glycerol, lactate, pyruvate, or succinate as the carbon and energy source. |
Mutants lacking citrate synthase (gltA) or isocitrate dehydrogenase (icd) are glutamate auxotrophs. The mutant lacking acnB doesn't have an absolutely requirement for glutamate because of the second aconitase activity (acnA). | |||
|
ΔacnB736::kan |
| ||||||
| edit table |
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Notes
Genetic Resources
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0114 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCTAGAAGAATACCGTAAGCA Primer 2:CCAACCGCAGTCTGGAAAATCAC | |
|
leuO3051::Tn10 |
Linked marker |
est. P1 cotransduction: 11% [6] Synonyms:zab-3051::Tn10
| |
|
Linked marker |
est. P1 cotransduction: 55% [6] | ||
| edit table |
See Help:Gene_resources for help entering information into the Genetic Resources table.
Notes
Accessions in Other Databases
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2: 2006.0008 PubMed EcoliWiki page
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 Gruer MJ et al. (1997) Construction and properties of aconitase mutants of Escherichia coli. Microbiology 143 ( Pt 6): 1837-46 PubMed EcoliWiki page
- ↑ Kitagawa M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (A Complete Set of E. coli K-12 ORF Archive): Unique Resources for Biological Research. DNA Res 12: 291-9 PubMed EcoliWiki page
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
