PortEco logo

acnB:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

acnB

Mnemonic

Aconitase

Synonyms

ECK0117, b0118, JW0114, yacI, yacJ[1], yacJ

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

2.84 minutes 

MG1655: 131615..134212


REL606

NC_012967: 134419..137016


BW2952

NC_012759: 131614..134211


W3110

 

W3110: 131615..134212


DH10B

DH10B: 105719..108316


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

131615

Edman degradation

PMID:8932712[2]
PMID:9298646[3]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

acnB(del) (Keio:JW0114)

deletion

deletion

PMID:16738554[4]

Shigen

CGSC8396[5]

acnB(del)::kan

deletion

Biolog:respiration

unable to respire Bromosuccinate

PMID:16095938[6]

acnB(del)::kan

deletion

Biolog:respiration

unable to respire L-Asparagine

PMID:16095938[6]

acnB(del)::kan

deletion

Biolog:respiration

unable to respire L-Aspartate

PMID:16095938[6]

acnB(del)::tetR

Internal deletion of acnB replaced with tetR gene.

Growth Phenotype

Cannot grow on acetate as the sole carbon and energy source with or without supplementation with glutamate.

PMID:9202458[7]

acnB(del)::tetR

Internal deletion of acnB substituted with tetR.

Growth Phenotype

Grows poorly on minimal glucose medium unless the medium is supplemented with glutamate. The same phenotype is seen for growth on minimal medium with glycerol, lactate, pyruvate, or succinate as the carbon and energy source.

PMID:9202458[7]

Mutants lacking citrate synthase (gltA) or isocitrate dehydrogenase (icd) are glutamate auxotrophs. The mutant lacking acnB doesn't have an absolutely requirement for glutamate because of the second aconitase activity (acnA).

acnB736(del)::kan

PMID:16738554[4]

CGSC:99896


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0114

Plasmid clone

Shigen

PMID:16769691[8]

Status:Clone OK

Primer 1:GCCCTAGAAGAATACCGTAAGCA

Primer 2:CCAACCGCAGTCTGGAAAATCAC

4D12

Kohara Phage

Genobase

PMID:3038334[9]

4E11

Kohara Phage

Genobase

PMID:3038334[9]

17C11

Kohara Phage

Genobase

PMID:3038334[9]

leuO3051::Tn10

Linked marker

CAG12095 = CGSC7324[5]

est. P1 cotransduction: 11% [10]
Synonyms:zab-3051::Tn10 nnnThe start of leuO was reannotated by Riley et al. (2006).

zad-220::Tn10

Linked marker

CAG12025 = CGSC7326[5]

est. P1 cotransduction: 55% [10]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG12316

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG12316

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002193

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:944864

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2222

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0000411

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Bradbury, AJ et al. (1996) The second aconitase (AcnB) of Escherichia coli. Microbiology (Reading, Engl.) 142 ( Pt 2) 389-400 PubMed EcoliWiki page
  3. Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed EcoliWiki page
  4. 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 6.2 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed EcoliWiki page
  7. 7.0 7.1 Gruer, MJ et al. (1997) Construction and properties of aconitase mutants of Escherichia coli. Microbiology (Reading, Engl.) 143 ( Pt 6) 1837-46 PubMed EcoliWiki page
  8. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  9. 9.0 9.1 9.2 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  10. 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories