PortEco logo

acpP:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

acpP

Mnemonic

Acyl carrier protein

Synonyms

ECK1080, b1094, JW1080[1], JW1080

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

BW2952

NC_012759: 1054763..1054999


MG1655

24.8 minutes 

MG1655: 1150838..1151074


REL606

NC_012967: 1166184..1166420


W3110

 

W3110: 1153192..1153428


DH10B

DH10B: 1206283..1206519


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

1150841

Edman degradation

PMID:2062368[2]
PMID:3549687[3]
PMID:4882207[4]
PMID:9119048[5]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

acpPS37A,T

S37A,T

Loss of phosphopantetheinylation, and inhibition of cell growth

seeded from UniProt:P0A6A8

Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW1080

Plasmid clone

Shigen

PMID:16769691[6]

Status:Clone OK

Primer 1:GCCAGCACTATCGAAGAACGCGT

Primer 2:CCgGCCTGGTGGCCGTTGATGTA

14C1

Kohara Phage

Genobase

PMID:3038334[7]

E9G1

Kohara Phage

Genobase

PMID:3038334[7]

zcc-282::Tn10

Linked marker

CAG18466 = CGSC7359[8]

est. P1 cotransduction: % [9]

zce-726::Tn10

Linked marker

CAG12078 = CGSC7361[8]

est. P1 cotransduction: 86% [9]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG50003

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG50003

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002562

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:944805

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB4297

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0003703

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Issartel, JP et al. (1991) Activation of Escherichia coli prohaemolysin to the mature toxin by acyl carrier protein-dependent fatty acylation. Nature 351 759-61 PubMed EcoliWiki page
  3. Jackowski, S & Rock, CO (1987) Altered molecular form of acyl carrier protein associated with beta-ketoacyl-acyl carrier protein synthase II (fabF) mutants. J. Bacteriol. 169 1469-73 PubMed EcoliWiki page
  4. Vanaman, TC et al. (1968) The complete amino acid sequence of the acyl carrier protein of Escherichia coli. J. Biol. Chem. 243 6420-31 PubMed EcoliWiki page
  5. Ohba, A et al. (1997) Amounts of proteins altered by mutations in the dnaA gene of Escherichia coli. FEBS Lett. 404 125-8 PubMed EcoliWiki page
  6. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  7. 7.0 7.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  8. 8.0 8.1 CGSC: The Coli Genetics Stock Center
  9. 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories