PortEco logo

acpS:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

acpS

Mnemonic

Acyl carrier protein

Synonyms

ECK2561, b2563, JW2547, dpj, G220[1][2]

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

58.16 minutes, 58.16 minutes 

MG1655: 2699020..2698640


REL606

NC_012967: 2622490..2622110


BW2952

NC_012759: 2584445..2584825


W3110

 

W3110: 2699654..2699274


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

2698643

Edman degradation

PMID:7559576[3]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

acpSG5D

G5D

5-fold reduction in catalytic activity

seeded from UniProt:P24224

acpS1

G4D substitution: G to A transition in the fifth codon (underlined), GCAATATTTAGATXx

G4D

Auxotrophies

G4D mutation causes a 5 fold reduction in catalytic efficiency, Fig. 7,8,9.

PMID:10625633[4]

Mutant K-12 strain used was e. coli MP4.

Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2547

Plasmid clone

Shigen

PMID:16769691[5]

Status:Clone OK

Primer 1:GCCGCAATATTAGGTTTAGGCAC

Primer 2:CCACTTTCAATAATTACCGTGGC

7G4

Kohara Phage

Genobase

PMID:3038334[6]

zfh-208::Tn10

Linked marker

CAG18481 = CGSC7417[7]

est. P1 cotransduction: 24% [8]
Synonyms:zff-208::Tn10

nadB51::Tn10

Linked marker

CAG18480 = CGSC7419[7]

est. P1 cotransduction: 69% [8]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10247

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10247

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000241

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:947037

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0243

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0008433

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. Lambalot, RH & Walsh, CT (1995) Cloning, overproduction, and characterization of the Escherichia coli holo-acyl carrier protein synthase. J. Biol. Chem. 270 24658-61 PubMed EcoliWiki page
  4. Flugel, RS et al. (2000) Holo-(acyl carrier protein) synthase and phosphopantetheinyl transfer in Escherichia coli. J. Biol. Chem. 275 959-68 PubMed EcoliWiki page
  5. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  6. Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  7. 7.0 7.1 CGSC: The Coli Genetics Stock Center
  8. 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories