PortEco logo

acrE:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

acrE

Mnemonic

Acridine

Synonyms

ECK3252, b3265, JW3233, G7979[1][2], envC

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

73.54 minutes 

MG1655: 3411886..3413043


REL606

NC_012967: 3341755..3342912


BW2952

NC_012759: 3299034..3300191


W3110

 

W3110: 3413719..3414876


DH10B

DH10B: 3509631..3510788


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Protein Binding Site (SO:0000410)

MG1655

-289bps from the translational start site

ROMA

PMID:15520470[3]

CRP binding site

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔacrE (Keio:JW3233)

deletion

deletion

PMID:16738554[4]

Shigen

acrE::Tn5KAN-I-SceI (FB21091)

Insertion at nt 611 in Minus orientation

PMID:15262929[5]

E. coli Genome Project:FB21091

contains pKD46

acrE::Tn5KAN-I-SceI (FB21092)

Insertion at nt 611 in Minus orientation

PMID:15262929[5]

E. coli Genome Project:FB21092

does not contain pKD46

Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW3233

Plasmid clone

Shigen

PMID:16769691[6]

Status:Clone OK

Primer 1:GCCACGAAACATGCCAGGTTTTT

Primer 2:CCtTTCGATGCAGTATCTGCGGG

6G3

Kohara Phage

Genobase

PMID:3038334[7]

6G9

Kohara Phage

Genobase

PMID:3038334[7]

zhc-6::Tn10

Linked marker

CAG12153 = CGSC7442[8]

est. P1 cotransduction: 11% [9]
Synonyms:zha-6::Tn10

acrF3083::Tn10

Linked marker

CAG12075 = CGSC7447[8]

est. P1 cotransduction: 91% [9]
Synonyms:zhd-3083::Tn10, zhe-3083::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10266

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10266

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000260

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:947706

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0262

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0010722

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. Zheng, D et al. (2004) Identification of the CRP regulon using in vitro and in vivo transcriptional profiling. Nucleic Acids Res. 32 5874-93 PubMed EcoliWiki page
  4. Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  5. 5.0 5.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  6. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  7. 7.0 7.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  8. 8.0 8.1 CGSC: The Coli Genetics Stock Center
  9. 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories