PortEco logo

ada:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

ada

Mnemonic

Adaptive (response)

Synonyms

ECK2205, b2213, JW2201[1], JW2201

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

49.73 minutes 

MG1655: 2308427..2307363


REL606

NC_012967: 2260509..2259445


BW2952

NC_012759: 2193168..2194232


W3110

 

W3110: 2313739..2312675


DH10B

DH10B: 2399415..2398351


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

2307363

Edman degradation

PMID:2987251[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

adaE75D

E75D

(in strain: B)

Strain variation; seeded from UniProt:P06134

adaAQ79PR

AQ79PR

(in strain: B)

Strain variation; seeded from UniProt:P06134

adaI318V

I318V

(in strain: B)

Strain variation; seeded from UniProt:P06134

adaT330S

T330S

(in strain: B)

Strain variation; seeded from UniProt:P06134

Δada (Keio:JW2201)

deletion

deletion

PMID:16738554[3]

Shigen
CGSC9780[4]

ada::Tn5KAN-2 (FB20708)

Insertion at nt 687 in Minus orientation

PMID:15262929[5]

E. coli Genome Project:FB20708

does not contain pKD46

ada::Tn5KAN-2 (FB20709)

Insertion at nt 687 in Minus orientation

PMID:15262929[5]

E. coli Genome Project:FB20709

contains pKD46

ada-1

CGSC:12943

ada-2

CGSC:12946

ada-3

CGSC:12948

ada-4

CGSC:12950

ada-5

CGSC:12952

ada-6

CGSC:12954

ada-766(del)::kan

PMID:16738554[3]

CGSC:99908


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2201

Plasmid clone

Shigen

PMID:16769691[6]

Status:Clone OK

Primer 1:GCCAAAAAAGCCACATGCTTAAC

Primer 2:CCtCTCTCCTCATTTTCAGCTTC

22A6

Kohara Phage

Genobase

PMID:3038334[7]

napA722::Tn10

Linked marker

CAG12098 = CGSC7400[4]

est. P1 cotransduction: 82% [8]
Synonyms:zeg-722, zei-722::Tn10

atoS298::Tn10

Linked marker

CAG12177 gyrA+ = CGSC7525[4]

est. P1 cotransduction: 65% [8]
Synonyms:zeh-298::Tn10, zej-298::Tn10 nnnThe original CAG12177 was NalR. This is a NalS derivative constructed by S. McAteer (CGSC).

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10029

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10029

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000026

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:946710

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0028

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0007311

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Nakabeppu, Y et al. (1985) Purification and structure of the intact Ada regulatory protein of Escherichia coli K12, O6-methylguanine-DNA methyltransferase. J. Biol. Chem. 260 7281-8 PubMed EcoliWiki page
  3. 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. 5.0 5.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  6. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  7. Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  8. 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories