PortEco logo

adhE:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

adhE

Mnemonic

Alcohol/acetaldehyde dehydrogenase

Synonyms

ECK1235, b1241, JW1228, adhC, ana[1], ana

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

27.9 minutes 

MG1655: 1297344..1294669


REL606

NC_012967: 1296914..1294239


BW2952

NC_012759: 1184167..1186842


W3110

 

W3110: 1299698..1297023


DH10B

DH10B: 1337585..1334910


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

1294672

Edman degradation

PMID:2015910[2]
PMID:2695398[3]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔadhE (Keio:JW1228)

deletion

deletion

PMID:16738554[4]

Shigen
CGSC9113[5]

adhE::Tn5KAN-2 (FB20272)

Insertion at nt 1923 in Plus orientation

PMID:15262929[6]

E. coli Genome Project:FB20272

does not contain pKD46

ΔadhE::kan

deletion

Biolog:respiration

unable to respire D-Mannose

PMID:16095938[7]

ana-1

CGSC:5096

adhE80

PMID:6986356[8]

CGSC:7028

adhE1

PMID:6752127[9]

CGSC:7285

adhE16(ts)

temperature sensitive

CGSC:7289

adhE2

PMID:6752127[9]

CGSC:7457

ana-2

adhE

CGSC:14693

adhE36

PMID:3550385[10]

CGSC:92529

adhE38

PMID:3550385[10]

CGSC:92530

ΔadhE748::kan

PMID:16738554[4]

CGSC:99914


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW1228

Plasmid clone

Shigen

PMID:16769691[11]

Status:Clone OK

Primer 1:GCCGCTGTTACTAATGTCGCTGA

Primer 2:CCAGCGGATTTTTTCGCTTTTTT

4D8

Kohara Phage

Genobase

PMID:3038334[12]

3D5

Kohara Phage

Genobase

PMID:3038334[12]

fadR13::Tn10

Linked marker

CAG18497 = CGSC7365[5]

est. P1 cotransduction: 4% [13]

oppC506::Tn10

Linked marker

CAG12169 = CGSC7369[5]

est. P1 cotransduction: 73% [13]
Synonyms:zch-506::Tn10, zci-506::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10031

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10031

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000028

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945837

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0030

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0004164

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Kessler, D et al. (1991) Pyruvate-formate-lyase-deactivase and acetyl-CoA reductase activities of Escherichia coli reside on a polymeric protein particle encoded by adhE. FEBS Lett. 281 59-63 PubMed EcoliWiki page
  3. Goodlove, PE et al. (1989) Cloning and sequence analysis of the fermentative alcohol-dehydrogenase-encoding gene of Escherichia coli. Gene 85 209-14 PubMed EcoliWiki page
  4. 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  7. Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed EcoliWiki page
  8. Clark, D & Cronan, JE Jr (1980) Escherichia coli mutants with altered control of alcohol dehydrogenase and nitrate reductase. J. Bacteriol. 141 177-83 PubMed EcoliWiki page
  9. 9.0 9.1 Lorowitz, W & Clark, D (1982) Escherichia coli mutants with a temperature-sensitive alcohol dehydrogenase. J. Bacteriol. 152 935-8 PubMed EcoliWiki page
  10. 10.0 10.1 Cunningham, PR & Clark, DP (1986) The use of suicide substrates to select mutants of Escherichia coli lacking enzymes of alcohol fermentation. Mol. Gen. Genet. 205 487-93 PubMed EcoliWiki page
  11. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  12. 12.0 12.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  13. 13.0 13.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories