PortEco logo

adk:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

adk

Mnemonic

Adenylate kinase

Synonyms

ECK0468, b0474, JW0463, dnaW, plsA[1], plsA

Notes

dnaW and adk were shown to be allelic by Henson an Walker[2].

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

10.7 minutes 

MG1655: 496399..497043


REL606

NC_012967: 469242..469886


BW2952

NC_012759: 399158..399802


W3110

 

W3110: 496399..497043


DH10B

DH10B: 435730..436374


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

496399

Edman degradation

PMID:3027060[3]
PMID:8650159[4]
PMID:9298646[5]
PMID:9600841[6]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

adkP9G

P9G

No loss of enzyme activity

seeded from UniProt:P69441

adkG10V

G10V

No loss of enzyme activity

seeded from UniProt:P69441

adkK13Q

K13Q

Drastic reduction in enzyme activity

seeded from UniProt:P69441

adk-15(ts)

temperature sensitive

CGSC:11623

adk-2(ts)

temperature sensitive

CGSC:11620

adk-31(ts)

temperature sensitive

CGSC:11625

adk-3(ts)

temperature sensitive

CGSC:11738

adk-9(ts)

temperature sensitive

CGSC:11756


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0463

Plasmid clone

Shigen

PMID:16769691[7]

Status:Clone OK

Primer 1:GCCCGTATCATTCTGCTTGGCGC

Primer 2:CCGCCGAGGATTTTTTCCAGATC

12H5

Kohara Phage

Genobase

PMID:3038334[8]

4B10

Kohara Phage

Genobase

PMID:3038334[8]

zaj-3054::Tn10

Linked marker

CAG12017 = CGSC7339[9]

est. P1 cotransduction: 22% [10]
Synonyms:zba-3054::Tn10

gsk-3055::Tn10

Linked marker

CAG12154 = CGSC7341[9]

est. P1 cotransduction: 86% [10]
Synonyms:zbb-30-55::TnlO, zba-3055::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10032

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10032

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000029

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945097

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0031

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0001645

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Henson, JM et al. (1982) The Escherichia coli dnaW mutation is an allele of the adk gene. Mol. Gen. Genet. 186 488-92 PubMed EcoliWiki page
  3. Saint Girons, I et al. (1987) Structural and catalytic characteristics of Escherichia coli adenylate kinase. J. Biol. Chem. 262 622-9 PubMed EcoliWiki page
  4. Lu, Q & Inouye, M (1996) Adenylate kinase complements nucleoside diphosphate kinase deficiency in nucleotide metabolism. Proc. Natl. Acad. Sci. U.S.A. 93 5720-5 PubMed EcoliWiki page
  5. Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed EcoliWiki page
  6. Wilkins, MR et al. (1998) Protein identification with N and C-terminal sequence tags in proteome projects. J. Mol. Biol. 278 599-608 PubMed EcoliWiki page
  7. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  8. 8.0 8.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  9. 9.0 9.1 CGSC: The Coli Genetics Stock Center
  10. 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories