PortEco logo

aer:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

aer

Mnemonic

Aerotaxis

Synonyms

ECK3062, b3072, JW3043, air, yqjJ[1], yqjJ

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

69.31 minutes 

MG1655: 3217098..3215578


REL606

NC_012967: 3151893..3150373


BW2952

NC_012759: 3102726..3104246


W3110

 

W3110: 3217732..3216212


DH10B

DH10B: 3314843..3313323


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

aer(del) (Keio:JW3043)

deletion

deletion

PMID:16738554[2]

Shigen

CGSC10324[3]

aer::Tn5KAN-I-SceI (FB21018)

Insertion at nt 133 in Plus orientation

PMID:15262929[4]

E. coli Genome Project:FB21018

does not contain pKD46

aer(del)::kan

deletion

Biolog:respiration

unable to respire a-Ketoglutarate

PMID:16095938[5]

aer(del)::kan

deletion

Biolog:respiration

unable to respire Bromosuccinate

PMID:16095938[5]

aer-3075::Tn10

Insertion at 3,216,315 bp in MG1655 (NC_000913)

adapted from Nichols et al.[6]

CAG12152 = CGSC7438[3]

Synonyms: zgh-3075::Tn10, zgj-3075::Tn10

aer-3159::Tn10kan

PMID:2540407[7] PMID:9829956[8]

CGSC:38749

aer-3075::Tn10

PMID:2540407[7] PMID:9829956[8]

CGSC:38759

aer-762(del)::kan

PMID:16738554[2]

CGSC:99926

aer(del)

deletion

deletion

in vivo

The streptomycin resistant mutation exhibited a decreased ability to colonize the intestine when compared to wild-type cells, figure 1.

PMID:19130287[9]


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW3043

Plasmid clone

Shigen

PMID:16769691[10]

Status:Clone OK

Primer 1:GCCTCTTCTCATCCGTATGTCAC

Primer 2:CCATGCAGTACCGTCACCGCGTC

19F2

Kohara Phage

Genobase

PMID:3038334[11]

17E4

Kohara Phage

Genobase

PMID:3038334[11]

tolC210::Tn10

Linked marker

CAG12184 = CGSC7437[3]

est. P1 cotransduction: 21% [6]

sfsB203::Tn10

Linked marker

CAG12072 = CGSC7440[3]

est. P1 cotransduction: % [6]
Synonyms:zgj-203::Tn10, zha-203::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G7595

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG12955

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120004149

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945301

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2789

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0010087

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  3. 3.0 3.1 3.2 3.3 CGSC: The Coli Genetics Stock Center
  4. Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  5. 5.0 5.1 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed EcoliWiki page
  6. 6.0 6.1 6.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  7. 7.0 7.1 Singer, M et al. (1989) A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli. Microbiol. Rev. 53 1-24 PubMed EcoliWiki page
  8. 8.0 8.1 Nichols, BP et al. (1998) Sequence analysis of Tn10 insertion sites in a collection of Escherichia coli strains used for genetic mapping and strain construction. J. Bacteriol. 180 6408-11 PubMed EcoliWiki page
  9. Horne, SM et al. (2009) An Escherichia coli aer mutant exhibits a reduced ability to colonize the streptomycin-treated mouse large intestine. Antonie Van Leeuwenhoek 95 149-58 PubMed EcoliWiki page
  10. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  11. 11.0 11.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page

Categories