PortEco logo

aes:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

aes

Mnemonic

Acetyl esterase

Synonyms

ECK0470, b0476, JW0465, ybaC[1], ybaC

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

10.74 minutes 

MG1655: 499197..498238


REL606

NC_012967: 472040..471081


BW2952

NC_012759: 400997..401956


W3110

 

W3110: 499197..498238


DH10B

DH10B: 438528..437569


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

498238

Edman degradation

PMID:9576853[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

aesD266A

D266A

Reduces enzymatic efficiency

seeded from UniProt:P23872

aesH292A

H292A

Abolishes enzymatic activity

seeded from UniProt:P23872

aesD164A

D164A

Strongly reduces enzymatic activity

seeded from UniProt:P23872

aesS165A

S165A

Abolishes enzymatic activity

seeded from UniProt:P23872

aesG167A

G167A

Diminishes substrate affinity

seeded from UniProt:P23872

aesD262A

D262A

Strongly reduces enzymatic activity

seeded from UniProt:P23872

aesG163A

G163A

Diminishes catalytic efficiency

seeded from UniProt:P23872

aesH103A

H103A

Reduces enzymatic efficiency

seeded from UniProt:P23872

aesE128A

E128A

Reduces enzymatic efficiency

seeded from UniProt:P23872

aes(del) (Keio:JW0465)

deletion

deletion

PMID:16738554[3]

Shigen

CGSC8617[4]

ybaC::Tn5KAN-I-SceI (FB20183)

Insertion at nt 604 in Plus orientation

PMID:15262929[5]

E. coli Genome Project:FB20183

does not contain pKD46

ybaC::Tn5KAN-I-SceI (FB20184)

Insertion at nt 604 in Plus orientation

PMID:15262929[5]

E. coli Genome Project:FB20184

contains pKD46

aes-758(del)::kan

PMID:16738554[3]

CGSC:99928


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0465

Plasmid clone

Shigen

PMID:16769691[6]

Status:Clone OK

Primer 1:GCCAAGCCGGAAAACAAACTACC

Primer 2:CCAAGCTGAGCGGTAAAGAACTG

12H5

Kohara Phage

Genobase

PMID:3038334[7]

4B10

Kohara Phage

Genobase

PMID:3038334[7]

zaj-3054::Tn10

Linked marker

CAG12017 = CGSC7339[4]

est. P1 cotransduction: 20% [8]
Synonyms:zba-3054::Tn10

gsk-3055::Tn10

Linked marker

CAG12154 = CGSC7341[4]

est. P1 cotransduction: 91% [8]
Synonyms:zbb-30-55::TnlO, zba-3055::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11101

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11101

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001089

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:947514

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1093

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0001651

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Kanaya, S et al. (1998) An esterase from Escherichia coli with a sequence similarity to hormone-sensitive lipase. Biochem. J. 332 ( Pt 1) 75-80 PubMed EcoliWiki page
  3. 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. 5.0 5.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  6. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  7. 7.0 7.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  8. 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories