E. coli is indeed the coolest thing on the planet - Carl Zimmer
agaW:On One Page
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
| Gene Name | |
|---|---|
| Product(s) |
AgaW product[2]: B3134 product, YhaZ product |
| Description |
PTS system N-acetylgalactosameine-specific IIC component 2[2][3] |
| Knock-Out Phenotype | |
| Regulation/Expression |
transcription unit(s): kbaZ-agaVWA[2], kbaZagaVWEFA, agaZVWA |
| Regulation/Activity | |
| edit table | |
See Help:Quickview for help with entering information in the Quickview table.
Notes
Gene
Nomenclature
| Standard name |
agaW |
|---|---|
| Mnemonic | |
| Synonyms |
ECK3122, b3134, JW3103, yhaZ[1] |
| edit table | |
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Notes
Location(s) and DNA Sequence
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
70.67 minutes |
MG1655: 3278723..3279124 | ||
|
W3110 |
|
W3110: 3280556..3280957 | ||
| edit table |
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Notes
Sequence Features
| Feature type | Location | Description |
|---|---|---|
| edit table |
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Notes
Alleles and Phenotypes
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔagaW (Keio:JW3103) |
deletion |
deletion | |||||
| edit table |
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Notes
Genetic Resources
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3103 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGAAATCAGCCTGTTGCAGGC Primer 2:CCAATGCGGCGCGGGTTTGTTGC | |
|
Linked marker |
est. P1 cotransduction: 3% [7] Synonyms:zgh-3075::Tn10, zgj-3075::Tn10 | ||
|
Linked marker |
est. P1 cotransduction: 8% [7] Synonyms:zgj-203::Tn10, zha-203::Tn10 | ||
| edit table |
See Help:Gene_resources for help entering information into the Genetic Resources table.
Notes
Accessions in Other Databases
| Database | Accession | Notes |
|---|---|---|
| edit table |
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
Categories
Product(s)
Nomenclature
| Standard name |
AgaW |
|---|---|
| Synonyms | |
| Product description |
PTS system N-acetylgalactosameine-specific IIC component 2[2][3] |
| EC number (for enzymes) |
|
| edit table |
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Notes
Function
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference(s) | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
| GO:0005351 |
sugar:hydrogen symporter activity |
IEA: Inferred from Electronic Annotation |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |||
| GO:0006810 |
transport |
IEA: Inferred from Electronic Annotation |
P |
Seeded from EcoCyc 12.5 [8] |
complete | |||
| GO:0008643 |
carbohydrate transport |
IEA: Inferred from Electronic Annotation |
P |
Seeded from EcoCyc 12.5 [8] |
complete | |||
| GO:0009401 |
phosphoenolpyruvate-dependent sugar phosphotransferase system |
IEA: Inferred from Electronic Annotation |
P |
Seeded from EcoCyc 12.5 [8] |
complete | |||
| GO:0016020 |
membrane |
IEA: Inferred from Electronic Annotation |
C |
Seeded from EcoCyc 12.5 [8] |
complete | |||
| GO:0016021 |
integral to membrane |
IEA: Inferred from Electronic Annotation |
C |
Seeded from EcoCyc 12.5 [8] |
complete | |||
| GO:0046349 |
amino sugar biosynthetic process |
P |
Seeded from EcoCyc 11.1[3]. |
required fields missing | ||||
| edit table |
Interactions
| Partner Type | Partner | Notes | References |
|---|---|---|---|
| edit table |
See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Notes
Localization
| Compartment | Description | Evidence | Notes |
|---|---|---|---|
|
plasma membrane |
C-terminus localized in the cytoplasm with 3 predicted transmembrane domains |
Daley et al. (2005) [9]/> |
|
| edit table |
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Notes
Structure and Physical Properties
Physical Properties
| Sequence |
MEISLLQAFA LGIIAFIAGL DMFNGLTHMH RPVVLGPLVG LVLGDLHTGI LTGGTLELVW MGLAPLAGAQ PPNVIIGTIV GTAFAITTGV KPDVAVGVAV PFAVAVQMGI TFLFSVMSGV MSRCDLATNP RRI |
|---|---|
| Mol. Wt |
13.72 kDa (calc) [2] |
| pI | |
| Extinction coefficient |
5500 - 5625 (calc based on 0 Y, 1 W, and 1 C residues) |
| edit table |
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki. |
Structure
| Structures |
|
|---|---|
| Models |
View models at: |
| edit table |
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.
Notes
Gene Product Resources
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Notes
Accessions in Other Databases
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
See Help:Product_accessions for help entering or editing information in this section of EcoliWiki.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
Categories
Expression
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Transcription and Transcriptional Regulation
| Figure courtesy of RegulonDB |
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
This picture shows the sequence around the N-terminus.
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
Mutations Affecting Expression
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Expression Studies
| Type | Reference | Notes |
|---|---|---|
|
microarray |
Summary of data for agaW from multiple microarray studies | |
|
microarray |
NCBI GEO profiles for agaW | |
| edit table |
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Expression Resources
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Notes
Accessions Related to agaW Expression
| Database | Accession | Notes |
|---|---|---|
| edit table |
See Help:Expression_accessions for help entering or editing information in this section of EcoliWiki.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
Categories
Evolution
Homologs in Other Organisms
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Shigella flexneri |
AGAW |
From SHIGELLACYC |
|
E. coli O157 |
Z4486 |
From ECOO157CYC |
| edit table |
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Do-It-Yourself Web Tools
Notes
Families
| Database | Accession | Notes |
|---|---|---|
| edit table |
See Help:Evolution_families for help entering or editing information in this section of EcoliWiki.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Baba T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2: 2006.0008 PubMed EcoliWiki page
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ Kitagawa M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (A Complete Set of E. coli K-12 ORF Archive): Unique Resources for Biological Research. DNA Res 12: 291-9 PubMed EcoliWiki page
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 8.0 8.1 8.2 8.3 8.4 8.5 EcoCyc (release 12.5; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Daley DO et al. (2005) Global topology analysis of the Escherichia coli inner membrane proteome. Science 308: 1321-3 PubMed EcoliWiki page
- ↑ 10.0 10.1 10.2 Krogh A et al. (2001) Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol 305: 567-80 PubMed EcoliWiki page
Categories
Categories: Gene List:MG1655 | Gene List:W3110 | Genes in the Keio knockout collection | Genes in the ASKA clone collection | aga genes | GO:0005351 ! sugar:hydrogen symporter activity | GO:0006810 ! transport | GO:0008643 ! carbohydrate transport | GO:0009401 ! phosphoenolpyruvate-dependent sugar phosphotransferase system | GO:0016020 ! membrane | GO:0016021 ! integral to membrane | GO:0046349 ! amino sugar biosynthetic process | TMHMM Prediction | Proteins | Txn unit:kbaZ-agaVWA | Genes with homologs in Shigella flexneri | Genes with homologs in E. coli O157


