PortEco logo

agp:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

agp

Mnemonic

Acid glucose-1-phosphatase

Synonyms

ECK0993, b1002, JW0987[1], JW0987

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

22.95 minutes 

MG1655: 1064808..1066049


REL606

NC_012967: 1081868..1083109


BW2952

NC_012759: 967776..969017


W3110

 

W3110: 1066007..1067248


DH10B

DH10B: 1118736..1119977


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

1064874

Edman degradation

PMID:2153660[2]
PMID:9298646[3]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

Δagp (Keio:JW0987)

deletion

deletion

PMID:16738554[4]

Shigen
CGSC8974[5]

agp::Tn5KAN-2 (FB20084)

Insertion at nt 327 in Minus orientation

PMID:15262929[6]

E. coli Genome Project:FB20084

does not contain pKD46

Δagp-746::kan

PMID:16738554[4]

CGSC:99952


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0987

Plasmid clone

Shigen

PMID:16769691[7]

Status:Clone OK

Primer 1:GCCAACAAAACGCTAATCGCCGC

Primer 2:CCTTTCACCGCTTCATTCAACAC

5A12

Kohara Phage

Genobase

PMID:3038334[8]

7B5

Kohara Phage

Genobase

PMID:3038334[8]

zcc-282::Tn10

Linked marker

CAG18466 = CGSC7359[5]

est. P1 cotransduction: 93% [9]

zce-726::Tn10

Linked marker

CAG12078 = CGSC7361[5]

est. P1 cotransduction: % [9]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10033

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10033

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000030

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945773

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0032

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0003388

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Pradel, E et al. (1990) Nucleotide sequence and transcriptional analysis of the Escherichia coli agp gene encoding periplasmic acid glucose-1-phosphatase. J. Bacteriol. 172 802-7 PubMed EcoliWiki page
  3. Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed EcoliWiki page
  4. 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  7. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  8. 8.0 8.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  9. 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories