PortEco logo

ahpC:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

ahpC

Mnemonic

Alkyl hydroperoxide

Synonyms

ECK0599, b0605, JW0598, ssi8[1][2], tpx

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

13.75 minutes 

MG1655: 638168..638731


REL606

NC_012967: 620996..621559


BW2952

NC_012759: 540928..541491


W3110

 

W3110: 638168..638731


DH10B

DH10B: 577500..578063


DH10B

DH10B: 690760..691323


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

638171

Edman degradation

PMID:1575737[3]
PMID:7499381[4]
PMID:8774726[5]
PMID:9298646[6]
PMID:9600841[7]
PMID:10094700[8]
PMID:10648109[9]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔahpC (Keio:JW0598)

deletion

deletion

PMID:16738554[10]

Shigen
CGSC8713[11]

ahpC*

triplet repeat expansion

PMID:18206967[12]

ΔahpC744::kan

PMID:16738554[10]

CGSC:99954


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0598

Plasmid clone

Shigen

PMID:16769691[13]

Status:Clone OK

Primer 1:GCCTCCTTGATTAACACCAAAAT

Primer 2:CCGATTTTACCAACCAGGTCCAG

4A5

Kohara Phage

Genobase

PMID:3038334[14]

3G5

Kohara Phage

Genobase

PMID:3038334[14]

dsbG601::Tn10

Linked marker

CAG12149 = CGSC7346[11]

est. P1 cotransduction: 92% [15]
Synonyms:zbd-601::Tn10, zbe-601::Tn10

crcA280::Tn10

Linked marker

CAG12077 = CGSC7347[11]

est. P1 cotransduction: 57% [15]
Synonyms:zbe-280::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11384

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11384

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001351

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945225

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1357

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0002090

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. Ueshima, R et al. (1992) Identification of Escherichia coli proteins cross-reacting with antibodies against region 2.2 peptide of RNA polymerase sigma subunit. Biochem. Biophys. Res. Commun. 184 634-9 PubMed EcoliWiki page
  4. Cha, MK et al. (1995) Thioredoxin-linked "thiol peroxidase" from periplasmic space of Escherichia coli. J. Biol. Chem. 270 28635-41 PubMed EcoliWiki page
  5. Quadroni, M et al. (1996) Analysis of global responses by protein and peptide fingerprinting of proteins isolated by two-dimensional gel electrophoresis. Application to the sulfate-starvation response of Escherichia coli. Eur. J. Biochem. 239 773-81 PubMed EcoliWiki page
  6. Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed EcoliWiki page
  7. Wilkins, MR et al. (1998) Protein identification with N and C-terminal sequence tags in proteome projects. J. Mol. Biol. 278 599-608 PubMed EcoliWiki page
  8. Blankenhorn, D et al. (1999) Acid- and base-induced proteins during aerobic and anaerobic growth of Escherichia coli revealed by two-dimensional gel electrophoresis. J. Bacteriol. 181 2209-16 PubMed EcoliWiki page
  9. Garbe, TR et al. (2000) Indole-inducible proteins in bacteria suggest membrane and oxidant toxicity. Arch. Microbiol. 173 78-82 PubMed EcoliWiki page
  10. 10.0 10.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  11. 11.0 11.1 11.2 CGSC: The Coli Genetics Stock Center
  12. Yamamoto, Y et al. (2008) Mutant AhpC peroxiredoxins suppress thiol-disulfide redox deficiencies and acquire deglutathionylating activity. Mol. Cell 29 36-45 PubMed EcoliWiki page
  13. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  14. 14.0 14.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  15. 15.0 15.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories