E. coli is indeed the coolest thing on the planet - Carl Zimmer
ahpC:On One Page
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
| Gene Name | |
|---|---|
| Product(s) |
AhpC product[1]: alkyl hydroperoxide reductase, C22 subunit product, B0605 product, Ssi8 product |
| Description |
Component of alkylhydroperoxide reductase[3] |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| edit table | |
See Help:Quickview for help with entering information in the Quickview table.
Notes
Gene
Nomenclature
| Standard name |
ahpC |
|---|---|
| Mnemonic | |
| Synonyms | |
| edit table | |
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Notes
Location(s) and DNA Sequence
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
13.75 minutes |
MG1655: 638168..638731 | ||
|
W3110 |
|
W3110: 638168..638731 | ||
| edit table |
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Notes
Sequence Features
| Feature type | Location | Description |
|---|---|---|
| edit table |
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Notes
Alleles and Phenotypes
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔahpC (Keio:JW0598) |
deletion |
deletion | |||||
|
ahpC* |
triplet repeat expansion |
Other | |||||
|
ΔahpC744::kan |
| ||||||
| edit table |
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Notes
Genetic Resources
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0598 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTCCTTGATTAACACCAAAAT Primer 2:CCGATTTTACCAACCAGGTCCAG | |
|
Linked marker |
est. P1 cotransduction: 92% [8] Synonyms:zbd-601::Tn10, zbe-601::Tn10 | ||
|
Linked marker |
est. P1 cotransduction: 57% [8] Synonyms:zbe-280::Tn10 | ||
| edit table |
See Help:Gene_resources for help entering information into the Genetic Resources table.
Notes
Accessions in Other Databases
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
Categories
Product(s)
Nomenclature
| Standard name |
AhpC |
|---|---|
| Synonyms |
alkyl hydroperoxide reductase, C22 subunit[1], B0605[2][1], AhpC[2][1], Ssi8[2][1] |
| Product description |
Component of ; alkylhydroperoxide reductase[3] |
| EC number (for enzymes) | |
| edit table |
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Notes
Function
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference(s) | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
| GO:0004601 |
peroxidase activity |
IEA: Inferred from Electronic Annotation |
F |
Seeded from EcoCyc 12.5 [9] |
complete | |||
| GO:0016209 |
antioxidant activity |
IEA: Inferred from Electronic Annotation |
F |
Seeded from EcoCyc 12.5 [9] |
complete | |||
| GO:0016491 |
oxidoreductase activity |
IEA: Inferred from Electronic Annotation |
F |
Seeded from EcoCyc 12.5 [9] |
complete | |||
| GO:0051920 |
peroxiredoxin activity |
IEA: Inferred from Electronic Annotation |
F |
Seeded from EcoCyc 12.5 [9] |
complete | |||
|
Under review | GO:0005624 |
membrane fraction |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc 12.5 [9] |
complete | ||
| GO:0005737 |
cytoplasm |
C |
Seeded from Riley et al 2006 [1]. |
required field missing | ||||
| GO:0006805 |
xenobiotic metabolic process |
IMP: Inferred from Mutant Phenotype |
P |
tetralin, cyclohexane and proplybenze catabolism. |
complete | |||
| GO:0004601 |
peroxidase activity |
IGI: Inferred from Genetic Interaction |
EcoliWiki:katG |
F |
complete | |||
| GO:0051920 |
peroxiredoxin activity |
IMP: Inferred from Mutant Phenotype |
F |
complete | ||||
| GO:0005737 |
cytoplasm |
IDA: Inferred from Direct Assay |
C |
complete | ||||
| GO:0016209 |
antioxidant activity |
IMP: Inferred from Mutant Phenotype |
F |
complete | ||||
| GO:0016684 |
oxidoreductase activity, acting on peroxide as acceptor |
IMP: Inferred from Mutant Phenotype |
F |
complete | ||||
| edit table |
Interactions
| Partner Type | Partner | Notes | References |
|---|---|---|---|
|
Protein |
Subunits of alkylhydroperoxide reductase |
could be indirect |
|
| edit table |
See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Notes
Localization
| Compartment | Description | Evidence | Notes |
|---|---|---|---|
|
cytoplasm |
| ||
| edit table |
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Notes
Structure and Physical Properties
Physical Properties
| Sequence |
MSLINTKIKP FKNQAFKNGE FIEITEKDTE GRWSVFFFYP ADFTFVCPTE LGDVADHYEE LQKLGVDVYA VSTDTHFTHK AWHSSSETIA KIKYAMIGDP TGALTRNFDN MREDEGLADR ATFVVDPQGI IQAIEVTAEG IGRDASDLLR KIKAAQYVAS HPGEVCPAKW KEGEATLAPS LDLVGKI |
|---|---|
| Mol. Wt |
20.76 kDa (calc) [2] |
| pI | |
| Extinction coefficient |
23950 - 24200 (calc based on 5 Y, 3 W, and 2 C residues) |
| edit table |
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Domains/Motifs/Modification Sites
| Type | Residues | Description | Notes |
|---|---|---|---|
|
Domain |
2 - 157 | ||
| edit table |
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
Structure
| Structures |
|
|---|---|
| Models |
View models at: |
| edit table |
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.
Notes
Gene Product Resources
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Notes
Accessions in Other Databases
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
See Help:Product_accessions for help entering or editing information in this section of EcoliWiki.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
Categories
Expression
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Transcription and Transcriptional Regulation
|  |
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
This picture shows the sequence around the N-terminus.
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
Mutations Affecting Expression
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Expression Studies
| Type | Reference | Notes |
|---|---|---|
|
microarray |
Summary of data for ahpC from multiple microarray studies | |
|
microarray |
NCBI GEO profiles for ahpC | |
| edit table |
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Expression Resources
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
|
GFP Fusion |
Intergenic region (637759..638206) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
| edit table |
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Notes
Accessions Related to ahpC Expression
| Database | Accession | Notes |
|---|---|---|
| edit table |
See Help:Expression_accessions for help entering or editing information in this section of EcoliWiki.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
Categories
Evolution
Homologs in Other Organisms
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Anopheles gambiae |
|
From Inparanoid:20070104 |
|
Apis mellifera |
|
From Inparanoid:20070104 |
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Bos taurus |
|
From Inparanoid:20070104 |
|
Caenorhabditis briggsae |
|
From Inparanoid:20070104 |
|
Caenorhabditis elegans |
|
From Inparanoid:20070104 |
|
Canis familiaris |
|
From Inparanoid:20070104 |
|
Ciona intestinalis |
|
From Inparanoid:20070104 |
|
Danio rerio |
|
From Inparanoid:20070104 |
|
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
|
Drosophila melanogaster |
|
From Inparanoid:20070104 |
|
Drosophila pseudoobscura |
|
From Inparanoid:20070104 |
|
Gallus gallus |
|
From Inparanoid:20070104 |
|
Homo sapiens |
|
From Inparanoid:20070104 |
|
Macaca mulatta |
|
From Inparanoid:20070104 |
|
Monodelphis domestica |
|
From Inparanoid:20070104 |
|
Mus musculus |
|
From Inparanoid:20070104 |
|
Oryza gramene |
|
From Inparanoid:20070104 |
|
Pan troglodytes |
|
From Inparanoid:20070104 |
|
Rattus norvegicus |
|
From Inparanoid:20070104 |
|
Saccharomyces cerevisiae |
|
From Inparanoid:20070104 |
|
Schizosaccharomyces pombe |
|
From Inparanoid:20070104 |
|
Takifugu rubripes |
|
From Inparanoid:20070104 |
|
Tetraodon nigroviridis |
|
From Inparanoid:20070104 |
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
AHPC |
From SHIGELLACYC |
|
E. coli O157 |
AHPC |
From ECOO157CYC |
| edit table |
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Do-It-Yourself Web Tools
Notes
Families
| Database | Accession | Notes |
|---|---|---|
| edit table |
See Help:Evolution_families for help entering or editing information in this section of EcoliWiki.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 Baba T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2: 2006.0008 PubMed EcoliWiki page
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ Yamamoto Y et al. (2008) Mutant AhpC peroxiredoxins suppress thiol-disulfide redox deficiencies and acquire deglutathionylating activity. Mol Cell 29: 36-45 PubMed EcoliWiki page
- ↑ Kitagawa M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (A Complete Set of E. coli K-12 ORF Archive): Unique Resources for Biological Research. DNA Res 12: 291-9 PubMed EcoliWiki page
- ↑ 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 9.0 9.1 9.2 9.3 9.4 EcoCyc (release 12.5; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Lasserre JP et al. (2006) A complexomic study of Escherichia coli using two-dimensional blue native/SDS polyacrylamide gel electrophoresis. Electrophoresis 27: 3306-21 PubMed EcoliWiki page
- ↑ 11.0 11.1 11.2 11.3 Ferrante AA et al. (1995) Cloning of an organic solvent-resistance gene in Escherichia coli: the unexpected role of alkylhydroperoxide reductase. Proc Natl Acad Sci U S A 92: 7617-21 PubMed EcoliWiki page
- ↑ Seaver LC & Imlay JA (2001) Alkyl hydroperoxide reductase is the primary scavenger of endogenous hydrogen peroxide in Escherichia coli. J Bacteriol 183: 7173-81 PubMed EcoliWiki page
- ↑ Cha MK et al. (1995) Thioredoxin-linked "thiol peroxidase" from periplasmic space of Escherichia coli. J Biol Chem 270: 28635-41 PubMed EcoliWiki page
- ↑ Zaslaver A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat Methods 3: 623-8 PubMed EcoliWiki page
Categories
Categories: Gene List:MG1655 | Gene List:W3110 | Genes in the Keio knockout collection | Genes in the ASKA clone collection | ahp genes | GO:0004601 ! peroxidase activity | GO:0016209 ! antioxidant activity | GO:0016491 ! oxidoreductase activity | GO:0051920 ! peroxiredoxin activity | GO:0005624 ! membrane fraction | GO:0005737 ! cytoplasm | GO:0006805 ! xenobiotic metabolic process | GO:0016684 ! oxidoreductase activity, acting on peroxide as acceptor | Proteins | Complex:alkylhydroperoxide reductase | Location:cytoplasm | Products with structures in PDB | GO Annotation by EcoliWiki Team | Genes in OpenBioSystems with Promoter Fusions | Txn unit:ahpCF | Genes with homologs in Anopheles gambiae | Genes with homologs in Apis mellifera | Genes with homologs in Arabidopsis thaliana | Genes with homologs in Bos taurus | Genes with homologs in Caenorhabditis briggsae | Genes with homologs in Caenorhabditis elegans | Genes with homologs in Canis familiaris | Genes with homologs in Ciona intestinalis | Genes with homologs in Danio rerio | Genes with homologs in Dictyostelium discoideum | Genes with homologs in Drosophila melanogaster | Genes with homologs in Drosophila pseudoobscura | Genes with homologs in Gallus gallus | Genes with homologs in Homo sapiens | Genes with homologs in Macaca mulatta | Genes with homologs in Monodelphis domestica | Genes with homologs in Mus musculus | Genes with homologs in Oryza gramene | Genes with homologs in Pan troglodytes | Genes with homologs in Rattus norvegicus | Genes with homologs in Saccharomyces cerevisiae | Genes with homologs in Schizosaccharomyces pombe | Genes with homologs in Takifugu rubripes | Genes with homologs in Tetraodon nigroviridis | Genes with homologs in Xenopus tropicalis | Genes with homologs in Shigella flexneri | Genes with homologs in E. coli O157
