PortEco logo

alaC:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

alaC

Mnemonic

Systematic nomenclature

Synonyms

yfdZ, ECK2375, b2379, JW2376[1], JW2376

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

53.78 minutes 

MG1655: 2496317..2495079


REL606

NC_012967: 2432519..2431281


BW2952

NC_012759: 2380884..2382122


W3110

 

W3110: 2503741..2502503


DH10B

DH10B: 2588082..2586844


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔyfdZ (Keio:JW2376)

deletion

deletion

PMID:16738554[2]

Shigen
CGSC9898[3]

ΔyfdZ788::kan

PMID:16738554[2]

CGSC:104728


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2376

Plasmid clone

Shigen

PMID:16769691[4]

Status:Clone OK

Primer 1:GCCGCTGACACTCGCCCTGAACG

Primer 2:CCTTCCGCGTTTTCGTGAATATG

zfd-1::Tn10

Linked marker

CAG18467 = CGSC7408[3]

est. P1 cotransduction: 89% [5]
Synonyms:zfb-1::Tn10

nupC510::Tn10

Linked marker

CAG18468 = CGSC7410[3]

est. P1 cotransduction: 59% [5]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G7242

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG14198

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003817

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:946850

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB3950

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0007850

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  3. 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
  4. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  5. 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories