PortEco logo

alaE:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

alaE

Mnemonic

Systematic nomenclature

Synonyms

ECK2664, b2670, JW2645, ygaW

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

60.29 minutes 

MG1655: 2797186..2797635


REL606

NC_012967: 2693916..2694365


BW2952

NC_012759: 2682998..2683447


W3110

 

W3110: 2797820..2798269


DH10B

DH10B: 2888951..2889400


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔygaW (Keio:JW2645)

deletion

deletion

PMID:16738554[1]

Shigen
CGSC10084[2]

ΔygaW751::kan

PMID:16738554[1]

CGSC:104872


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2645

Plasmid clone

Shigen

PMID:16769691[3]

Status:Clone OK

Primer 1:GCCTTCTCACCGCAGTCACGCTT

Primer 2:CCGGCTTTTACCTGCTGGTAACG

10H9

Kohara Phage

Genobase

PMID:3038334[4]

8G10

Kohara Phage

Genobase

PMID:3038334[4]

pheA18::Tn10

Linked marker

CAG12158 = CGSC7421[2]

est. P1 cotransduction: 5% [5]

srlD3131::Tn10

Linked marker

CAG18642 = CGSC7423[2]

est. P1 cotransduction: 33% [5]
Synonyms:zfh-3131::Tn10, zfi-3131::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (EcoliWiki Page)

GeneID:947147

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.0 1.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  2. 2.0 2.1 2.2 CGSC: The Coli Genetics Stock Center
  3. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  4. 4.0 4.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  5. 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories