PortEco logo

aldA:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

aldA

Mnemonic

Aldehyde dehydrogenase

Synonyms

ECK1408, b1415, JW1412, ald[1], ald

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

32.03 minutes 

MG1655: 1486256..1487695


REL606

NC_012967: 1457563..1459002


BW2952

NC_012759: 1378315..1379754


W3110

 

W3110: 1489946..1491385


DH10B

DH10B: 1576851..1578290


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

1486259

Edman degradation

PMID:1917845[2]
PMID:9298646[3]
PMID:9732527[4]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔaldA (Keio:JW1412)

deletion

deletion

PMID:16738554[5]

Shigen
CGSC9239[6]

aldA::Tn5KAN-2 (FB20313)

Insertion at nt 297 in Minus orientation

PMID:15262929[7]

E. coli Genome Project:FB20313

contains pKD46

ΔaldA776::kan

PMID:16738554[5]

CGSC:99962


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW1412

Plasmid clone

Shigen

PMID:16769691[8]

Status:Clone OK

Primer 1:GCCTCAGTACCCGTTCAACATCC

Primer 2:CCAGACTGTAAATAAACCACCTG

3C9

Kohara Phage

Genobase

PMID:3038334[9]

24D6

Kohara Phage

Genobase

PMID:3038334[9]

zhj-3076::Tn10

Linked marker

CAG18640 = CGSC7453[6]

est. P1 cotransduction: 8% [10]

trg-2::Tn10

Linked marker

CAG12026 = CGSC7376[6]

est. P1 cotransduction: 77% [10]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10035

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10035

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000032

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945672

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0034

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0004725

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Hidalgo, E et al. (1991) Molecular cloning and DNA sequencing of the Escherichia coli K-12 ald gene encoding aldehyde dehydrogenase. J. Bacteriol. 173 6118-23 PubMed EcoliWiki page
  3. Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed EcoliWiki page
  4. Rompf, A et al. (1998) Changes in protein synthesis as a consequence of heme depletion in Escherichia coli. Curr. Microbiol. 37 226-30 PubMed EcoliWiki page
  5. 5.0 5.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  6. 6.0 6.1 6.2 CGSC: The Coli Genetics Stock Center
  7. Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  8. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  9. 9.0 9.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  10. 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories