PortEco logo

alsE:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

alsE

Mnemonic

Allose

Synonyms

ECK4078, b4085, JW4046, yjcU[1], yjcU

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

92.8 minutes, 92.8 minutes 

MG1655: 4306501..4305806


REL606

NC_012967: 4287300..4286605


BW2952

NC_012759: 4244541..4245236


W3110

 

W3110: 4313156..4312461


DH10B

DH10B: 4406863..4406168


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔalsE (Keio:JW4046)

deletion

deletion

PMID:16738554[2]

Shigen
CGSC10912[3]

ΔalsE780::kan

PMID:16738554[2]

CGSC:99986


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW4046

Plasmid clone

Shigen

PMID:16769691[4]

Status:Clone OK

Primer 1:GCCAAAATCTCCCCCTCGTTAAT

Primer 2:CCTGCTGTTTTTGCATGAGGCTG

12A6

Kohara Phage

Genobase

PMID:3038334[5]

10H5

Kohara Phage

Genobase

PMID:3038334[5]

zje-2241::Tn10

Linked marker

CAG18427 = CGSC7481[3]

est. P1 cotransduction: 99% [6]

cadB2231::Tn10

Linked marker

CAG18488 = CGSC7479[3]

est. P1 cotransduction: 9% [6]
Synonyms:zjd-2231::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11957

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11957

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001884

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:948595

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1900

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0013382

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  3. 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
  4. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  5. 5.0 5.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories