PortEco logo

amiB:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

amiB

Mnemonic

amidase Amidase

Synonyms

ECK4165, b4169, JW4127, yjeD[1], yjeD

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

94.71 minutes 

MG1655: 4394088..4395425


REL606

NC_012967: 4374220..4375557


BW2952

NC_012759: 4332823..4334160


W3110

 

W3110: 4400745..4402082


DH10B

DH10B: 4494450..4495787


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔamiB (Keio:JW4127)

deletion

deletion

PMID:16738554[2]

Shigen
CGSC10970[3]

ΔamiB790::kan

PMID:16738554[2]

CGSC:99992

ΔamiB ΔamiA ΔamiC

deletion

deletion

Cell Shape

defect in cell separation

PMID:19525345[4]

Strain BW2952

C309T

T708C

PMID:19376874[5]

Relative to MG1655.

amiABC(del)

Growth Phenotype

when Supplying cells with the cell-wall precursor murein tripeptide (AeK) labeled with NBD accumulation of AeK-NBD occurs at division site indicating labeled precursors are utilized for septal peptidoglycan synthesis and amiC activity is mainly responsible for the rapid removal of labeled murein peptides at division sites as indicated by double mutant amiAB(del), figure 7.

PMID:21472954[6]


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW4127

Plasmid clone

Shigen

PMID:16769691[7]

Status:Clone OK

Primer 1:GCCATGTATCGCATCAGAAATTG

Primer 2:CCGTTTGGCAGCGTGCGATCTGG

3A1

Kohara Phage

Genobase

PMID:3038334[8]

cadB2231::Tn10

Linked marker

CAG18488 = CGSC7479[3]

est. P1 cotransduction: 21% [9]
Synonyms:zjd-2231::Tn10

cycA30::Tn10

Linked marker

CAG12073 = CGSC7482[3]

est. P1 cotransduction: 28% [9]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11363

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11363

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001332

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:948683

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1338

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0013653

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  3. 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
  4. Uehara, T et al. (2009) LytM-domain factors are required for daughter cell separation and rapid ampicillin-induced lysis in Escherichia coli. J. Bacteriol. 191 5094-107 PubMed EcoliWiki page
  5. Ferenci, T et al. (2009) Genomic sequencing reveals regulatory mutations and recombinational events in the widely used MC4100 lineage of Escherichia coli K-12. J. Bacteriol. 191 4025-9 PubMed EcoliWiki page
  6. Olrichs, NK et al. (2011) A novel in vivo cell-wall labeling approach sheds new light on peptidoglycan synthesis in Escherichia coli. Chembiochem 12 1124-33 PubMed EcoliWiki page
  7. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  8. Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  9. 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories