PortEco logo

ampC:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

ampC

Mnemonic

Ampicillin

Synonyms

ECK4146, b4150, JW4111, ampA[1], ampA

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

94.31 minutes, 94.31 minutes 

MG1655: 4376967..4375834


REL606

NC_012967: 4357655..4356522


BW2952

NC_012759: 4314569..4315702


W3110

 

W3110: 4383624..4382491


DH10B

DH10B: 4477329..4476196


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

4375837

Edman degradation

PMID:6795623[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ampCS80D,E,G

S80D,E,G

Loss of activity

seeded from UniProt:P00811

ampCK83Q,T

K83Q,T

Lowers activity more than 1000- fold and increases protein stability

seeded from UniProt:P00811

ampCK331A

K331A

Lowers activity more than 1000- fold

seeded from UniProt:P00811

ampCN168D,H

N168D,H

Lowers activity more than 1000- fold

seeded from UniProt:P00811

ampCY166E

Y166E

Lowers activity more than 1000- fold

seeded from UniProt:P00811

ampC(del) (Keio:JW4111)

deletion

deletion

PMID:16738554[3]

Shigen
CGSC10960[4]

ampC12

CGSC:10039

ampC11

CGSC:11804

ampC3

CGSC:11809

ampC777(del)::kan

PMID:16738554[3]

CGSC:99998

ampC

Resistant to

ampicillin resistance

PMID:4945191[5]

ampC

Gene duplication in the ampC gene region

Resistant to

Ampicillin-hyperresistant mutants of Ecoli K12 with multiple gene duplications in the ampC gene region overproduced at least six proteins during anaerobic growth. All but two of the proteins were also overproduced during aerobic growth.

PMID:391567[6]

ampA1

Resistant to

Resistant to Penicillins

PMID:391567[6]

Referenced At: PMID:334718[7] & PMID:4904235[8]

Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW4111

Plasmid clone

Shigen

PMID:16769691[9]

Status:Clone OK

Primer 1:GCCTTCAAAACGACGCTCTGCGC

Primer 2:CCtTGTAGAGCGTTAAGAATCTG

1D4

Kohara Phage

Genobase

PMID:3038334[10]

3H6

Kohara Phage

Genobase

PMID:3038334[10]

cadB2231::Tn10

Linked marker

CAG18488 = CGSC7479[4]

est. P1 cotransduction: 50% [11]
Synonyms:zjd-2231::Tn10

cycA30::Tn10

Linked marker

CAG12073 = CGSC7482[4]

est. P1 cotransduction: 10% [11]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10040

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10040

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000036

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:948669

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0038

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0013592

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Jaurin, B & Grundström, T (1981) ampC cephalosporinase of Escherichia coli K-12 has a different evolutionary origin from that of beta-lactamases of the penicillinase type. Proc. Natl. Acad. Sci. U.S.A. 78 4897-901 PubMed EcoliWiki page
  3. 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. Eriksson-Grennberg, KR et al. (1971) Resistance of Escherichia coli to penicillins. IX. Genetics and physiology of class II ampicillin-resistant mutants that are galactose negative or sensitive to bacteriophage C21, or both. J. Bacteriol. 108 1210-23 PubMed EcoliWiki page
  6. 6.0 6.1 Cole, ST & Guest, JR (1979) Production of a soluble form of fumarate reductase by multiple gene duplication in Escherichia coli K12. Eur. J. Biochem. 102 65-71 PubMed EcoliWiki page
  7. Normark, S & Burman, LG (1977) Resistance of Escherichia coli to penicillins: fine-structure mapping and dominance of chromosomal beta-lactamase mutations. J. Bacteriol. 132 1-7 PubMed EcoliWiki page
  8. Held, WA & Smith, OH (1970) Mechanism of 3-methylanthranilic acid derepression of the tryptophan operon in Escherichia coli. J. Bacteriol. 101 209-17 PubMed EcoliWiki page
  9. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  10. 10.0 10.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  11. 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories