PortEco logo

appB:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

appB

Mnemonic

Acid (poly)phosphatase

Synonyms

ECK0970, b0979, JW0961, cyxB, cbdB[1], cbdB

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

22.38 minutes 

MG1655: 1038519..1039655


REL606

NC_012967: 1056387..1057523


BW2952

NC_012759: 941487..942623


W3110

 

W3110: 1039718..1040854


DH10B

DH10B: 1092447..1093583


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔappB (Keio:JW0961)

deletion

deletion

PMID:16738554[2]

Shigen
CGSC8957[3]

appB::Tn5KAN-2 (FB20079)

Insertion at nt 1071 in Minus orientation

PMID:15262929[4]

E. coli Genome Project:FB20079

does not contain pKD46

ΔappB::kan

deletion

Biolog:respiration

unable to respire D-Mannose

PMID:16095938[5]

ΔappB::kan

deletion

Biolog:respiration

unable to respire a-Ketoglutarate

PMID:16095938[5]

ΔappB722::kan

PMID:16738554[2]

CGSC:100018


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0961

Plasmid clone

Shigen

PMID:16769691[6]

Status:Clone OK

Primer 1:GCCTTTGATTATGAAACATTGCG

Primer 2:CCGTACAACTCGTTTTCGTTACG

4H9

Kohara Phage

Genobase

PMID:3038334[7]

4H11

Kohara Phage

Genobase

PMID:3038334[7]

zcb-3059::Tn10

Linked marker

CAG12094 = CGSC7358[3]

est. P1 cotransduction: 23% [8]

zcc-282::Tn10

Linked marker

CAG18466 = CGSC7359[3]

est. P1 cotransduction: 41% [8]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11379

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11379

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001347

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:947547

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1353

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0003302

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  3. 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
  4. Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  5. 5.0 5.1 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed EcoliWiki page
  6. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  7. 7.0 7.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  8. 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories