PortEco logo

apt:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

apt

Mnemonic

Adenosine phosphoribosyl transferase

Synonyms

ECK0463, b0469, JW0458[1], JW0458

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

10.57 minutes 

MG1655: 490636..491187


REL606

NC_012967: 463479..464030


BW2952

NC_012759: 393395..393946


W3110

 

W3110: 490636..491187


DH10B

DH10B: 429967..430518


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

490636

Edman degradation

PMID:9573169[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

Δapt (Keio:JW0458)

deletion

deletion

PMID:16738554[3]

Shigen

apt::Tn5KAN-2 (FB20182)

Insertion at nt 421 in Minus orientation

PMID:15262929[4]

E. coli Genome Project:FB20182

does not contain pKD46

apt-110

CGSC:7460

apt-210

CGSC:7469


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0458

Plasmid clone

Shigen

PMID:16769691[5]

Status:Clone OK

Primer 1:GCCACCGCGACTGCACAGCAGCT

Primer 2:CCATGGCCCGGGAACGGGACAAG

8C4

Kohara Phage

Genobase

PMID:3038334[6]

12H5

Kohara Phage

Genobase

PMID:3038334[6]

zaj-3054::Tn10

Linked marker

CAG12017 = CGSC7339[7]

est. P1 cotransduction: 29% [8]
Synonyms:zba-3054::Tn10

gsk-3055::Tn10

Linked marker

CAG12154 = CGSC7341[7]

est. P1 cotransduction: 70% [8]
Synonyms:zbb-30-55::TnlO, zba-3055::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10051

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10051

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000047

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945113

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0049

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0001628

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Zhang, X et al. (1998) Oligoribonuclease is encoded by a highly conserved gene in the 3'-5' exonuclease superfamily. J. Bacteriol. 180 2779-81 PubMed EcoliWiki page
  3. Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  5. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  6. 6.0 6.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  7. 7.0 7.1 CGSC: The Coli Genetics Stock Center
  8. 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories