PortEco logo

araA:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

araA

Mnemonic

Arabinose

Synonyms

ECK0063, b0062, JW0061[1], JW0061

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

1.44 minutes 

MG1655: 68337..66835


REL606

NC_012967: 71141..69639


BW2952

NC_012759: 66834..68336


W3110

 

W3110: 68337..66835


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

araA2

CGSC:11825

araA855(polar)

CGSC:8504

araA202

CGSC:14406

araA289

CGSC:18976

araA204

CGSC:27481

araA207

CGSC:27484

araA213

CGSC:27487

araA254

CGSC:27523


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0061

Plasmid clone

Shigen

PMID:16769691[2]

Status:Clone OK

Primer 1:GCCACGATTTTTGATAATTATGA

Primer 2:CCGCGACGAAACCCGTAATACAC

5H5

Kohara Phage

Genobase

PMID:3038334[3]

8H11

Kohara Phage

Genobase

PMID:3038334[3]

carB96::Tn10

Linked marker

CAG12093 = CGSC7322[4]

est. P1 cotransduction: 25% [5]
Synonyms:car-96::Tn10

leuO3051::Tn10

Linked marker

CAG12095 = CGSC7324[4]

est. P1 cotransduction: 55% [5]
Synonyms:zab-3051::Tn10 nnnThe start of leuO was reannotated by Riley et al. (2006).

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10052

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10052

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000048

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:947511

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0050

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0000221

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  3. 3.0 3.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  4. 4.0 4.1 CGSC: The Coli Genetics Stock Center
  5. 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories