PortEco logo

araC:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

araC

Mnemonic

Arabinose

Synonyms

ECK0065, b0064, JW0063[1], JW0063

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

1.52 minutes 

MG1655: 70387..71265


REL606

NC_012967: 73191..74069


BW2952

NC_012759: 70386..71264


W3110

 

W3110: 70387..71265


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

70390

Edman degradation

PMID:7019009[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

araC(del) (Keio:JW0063)

deletion

deletion

PMID:16738554[3]

Shigen

araC14

CGSC:4493

araC2022(Const)

constitutive

CGSC:6926

araC859

CGSC:8508

araC766(del)

CGSC:10895

araC17

CGSC:13810

araC203

CGSC:14408

araC510

CGSC:14414

araC219

CGSC:27427

araC205

CGSC:27482

araC212

CGSC:27486

araC221

CGSC:27490

araC501

CGSC:27494

araC502

CGSC:27495

araC505

CGSC:27496

araC506

CGSC:27497

araC60

CGSC:27516

araC64

CGSC:27517

araC67

CGSC:27518

araC70

CGSC:27519

araC605(FucR, Const)

"D-fucose resistant, constitutive"

CGSC:27569


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0063

Plasmid clone

Shigen

PMID:16769691[4]

Status:Clone OK

Primer 1:GCCGCTGAAGCGCAAAATGATCC

Primer 2:CCTGACAACTTGACGGCTACAT

5H5

Kohara Phage

Genobase

PMID:3038334[5]

8H11

Kohara Phage

Genobase

PMID:3038334[5]

carB96::Tn10

Linked marker

CAG12093 = CGSC7322[6]

est. P1 cotransduction: 21% [7]
Synonyms:car-96::Tn10

leuO3051::Tn10

Linked marker

CAG12095 = CGSC7324[6]

est. P1 cotransduction: 63% [7]
Synonyms:zab-3051::Tn10 nnnThe start of leuO was reannotated by Riley et al. (2006).

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10054

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10054

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000050

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:944780

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0052

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0000236

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Wallace, RG et al. (1980) The araC gene of Escherichia coli: transcriptional and translational start-points and complete nucleotide sequence. Gene 12 179-90 PubMed EcoliWiki page
  3. Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  5. 5.0 5.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  6. 6.0 6.1 CGSC: The Coli Genetics Stock Center
  7. 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories