PortEco logo

araD:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

araD

Mnemonic

Arabinose

Synonyms

ECK0062, b0061, JW0060[1], JW0060

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

1.42 minutes 

MG1655: 66550..65855


REL606

NC_012967: 69354..68659


BW2952

NC_012759: 65855..66549


W3110

 

W3110: 66550..65855


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

65855

Edman degradation

PMID:8520491[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

araDV50I

V50I

Strain variation; seeded from UniProt:P08203

araDT70A

T70A

Strain variation; seeded from UniProt:P08203

araDD216N

D216N

Strain variation; seeded from UniProt:P08203

araD53

CGSC:14410

[araD139]

arabinose sensitive

CGSC:7064

null allele

araD591

CGSC:18969

araD54

CGSC:27568

araD138

CGSC:74738


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0060

Plasmid clone

Shigen

PMID:16769691[3]

Status:Clone OK

Primer 1:GCCTTAGAAGATCTCAAACGCCA

Primer 2:CCCTGCCCGTAATATGCCTTCGC

5H5

Kohara Phage

Genobase

PMID:3038334[4]

carB96::Tn10

Linked marker

CAG12093 = CGSC7322[5]

est. P1 cotransduction: 26% [6]
Synonyms:car-96::Tn10

leuO3051::Tn10

Linked marker

CAG12095 = CGSC7324[5]

est. P1 cotransduction: 53% [6]
Synonyms:zab-3051::Tn10 nnnThe start of leuO was reannotated by Riley et al. (2006).

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10055

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10055

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000051

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945294

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0053

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0000209

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Andersson, A et al. (1995) Purification and preliminary X-ray crystallographic studies of recombinant L-ribulose-5-phosphate 4-epimerase from Escherichia coli. Protein Sci. 4 1648-50 PubMed EcoliWiki page
  3. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  4. Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  5. 5.0 5.1 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories