PortEco logo

araF:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

araF

Mnemonic

Arabinose

Synonyms

ECK1899, b1901, JW1889[1], JW1889

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

42.74 minutes 

MG1655: 1984152..1983163


REL606

NC_012967: 1964122..1963133


BW2952

NC_012759: 1875646..1876635


W3110

 

W3110: 1988265..1987276


DH10B

DH10B: 2075160..2074171


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

1983166

Edman degradation

PMID:326784[2]
PMID:9298646[3]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

araFP277G

P277G

Improves binding to galactose

seeded from UniProt:P02924

ΔaraF (Keio:JW1889)

deletion

deletion

PMID:16738554[4]

Shigen
CGSC9571[5]

araF::Tn5KAN-2 (FB20510)

Insertion at nt 512 in Minus orientation

PMID:15262929[6]

E. coli Genome Project:FB20510

contains pKD46

araF::Tn5KAN-2 (FB20511)

Insertion at nt 512 in Minus orientation

PMID:15262929[6]

E. coli Genome Project:FB20511

does not contain pKD46

araF432

CGSC:80485

araF434

CGSC:80488

ΔaraF751::kan

PMID:16738554[4]

CGSC:100026


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW1889

Plasmid clone

Shigen

PMID:16769691[7]

Status:Clone OK

Primer 1:GCCCACAAATTTACTAAAGCCCT

Primer 2:CCtTTACCGCCTAAACCTTTTTT

7F11

Kohara Phage

Genobase

PMID:3038334[8]

18A9

Kohara Phage

Genobase

PMID:3038334[8]

16B12

Kohara Phage

Genobase

PMID:3038334[8]

eda-51::Tn10

Linked marker

CAG18486 = CGSC7392[5]

est. P1 cotransduction: 8% [9]

uvrC279::Tn10

Linked marker

CAG12156 = CGSC7394[5]

est. P1 cotransduction: 78% [9]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10057

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10057

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000053

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:946409

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0055

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0006330

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Hogg, RW & Hermodson, MA (1977) Amino acid sequence of the L-arabinose-binding protein from Escherichia coli B/r. J. Biol. Chem. 252 5135-41 PubMed EcoliWiki page
  3. Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed EcoliWiki page
  4. 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  7. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  8. 8.0 8.1 8.2 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  9. 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories