PortEco logo

arcB:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

arcB

Mnemonic

Aerobic respiration control

Synonyms

ECK3200, b3210, JW5536[1], JW5536

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

72.18 minutes 

MG1655: 3351047..3348711


REL606

NC_012967: 3288260..3285924


BW2952

NC_012759: 3235859..3238195


W3110

 

W3110: 3352880..3350544


DH10B

DH10B: 3448792..3446456


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

arcBH292Q

H292Q

Loss of activity

seeded from UniProt:P0AEC3

arcBD576A

D576A

Loss of activity

seeded from UniProt:P0AEC3

arcBH717Q

H717Q

Loss of activity

seeded from UniProt:P0AEC3

arcB(del) (Keio:JW5536)

deletion

deletion

PMID:16738554[2]

Shigen
CGSC11593[3]

arcB41(del-ins,::FRT)

PMID:10829079[4]

CGSC:65938

arcB40(del-ins)::cat

PMID:10829079[4]

CGSC:65940

arcB738(del)::kan

PMID:16738554[2]

CGSC:112242

arcB1

ECL619

Growth Phenotype

Codependant with arcB2 for pilus formation

PMID:2565334[5]

arcB2

ECL620

Growth Phenotype

codependant with arcB1 for pilus formation

PMID:2565334[5]

CAG45114 arcB738(del)::FRTKanFRT

Deletion

SigmaE activity

Increase in sigmaE activity

PMID:23224554[6]

Parental Strain: CAG45114 Experimental Strain: SMR15364

See table S11 for full experimental results.

Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW5536

Plasmid clone

Shigen

PMID:16769691[7]

Status:cloned as old JW

Primer 1:GCCAAGCAAATTCGTCTGCTGGC

Primer 2:CCTTTTTTAGTGGCTTTTGCCAC

7E3

Kohara Phage

Genobase

PMID:3038334[8]

3G10

Kohara Phage

Genobase

PMID:3038334[8]

8D6

Kohara Phage

Genobase

PMID:3038334[8]

sfsB203::Tn10

Linked marker

CAG12072 = CGSC7440[3]

est. P1 cotransduction: 54% [9]
Synonyms:zgj-203::Tn10, zha-203::Tn10

zhc-6::Tn10

Linked marker

CAG12153 = CGSC7442[3]

est. P1 cotransduction: 59% [9]
Synonyms:zha-6::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10062

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10062

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000058

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:947887

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0060

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0010537

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  3. 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
  4. 4.0 4.1 Datsenko, KA & Wanner, BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97 6640-5 PubMed EcoliWiki page
  5. 5.0 5.1 Iuchi, S et al. (1989) Differentiation of arcA, arcB, and cpxA mutant phenotypes of Escherichia coli by sex pilus formation and enzyme regulation. J. Bacteriol. 171 2889-93 PubMed EcoliWiki page
  6. Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed EcoliWiki page
  7. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  8. 8.0 8.1 8.2 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  9. 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories