PortEco logo

argC:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

argC

Mnemonic

Arginine

Synonyms

ECK3949, b3958, JW3930, Arg2[1], Arg2, argH

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

89.51 minutes 

MG1655: 4153024..4154028


REL606

NC_012967: 4134862..4135866


BW2952

NC_012759: 4042693..4043697


W3110

 

W3110: 3481680..3480676


DH10B

DH10B: 4252721..4253725


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔargC (Keio:JW3930)

deletion

deletion

Auxotrophies

PMID:16738554[2]

Shigen

CGSC10839[3]

ΔargC::kan

deletion

Biolog:respiration

unable to respire D-Sorbitol

PMID:16095938[4]

ΔargC::kan

deletion

Biolog:respiration

unable to respire DL-a-Glycerol

PMID:16095938[4]

ΔargC::kan

deletion

Biolog:respiration

unable to respire D-Galactoniate

PMID:16095938[4]

ΔargC::kan

deletion

Biolog:respiration

unable to respire D-Galacturonate

PMID:16095938[4]

ΔargC::kan

deletion

Biolog:respiration

unable to respire D-Glucuronate

PMID:16095938[4]

ΔargC::kan

deletion

Biolog:respiration

unable to respire Acetate

PMID:16095938[4]

ΔargC::kan

deletion

Biolog:respiration

unable to respire a-Ketoglutarate

PMID:16095938[4]

ΔargC::kan

deletion

Biolog:respiration

unable to respire DL-Lactate

PMID:16095938[4]

ΔargC::kan

deletion

Biolog:respiration

unable to respire Succinate

PMID:16095938[4]

ΔargC::kan

deletion

Biolog:respiration

unable to respire Bromosuccinate

PMID:16095938[4]

ΔargC::kan

deletion

Biolog:respiration

unable to respire Glucuronamide

PMID:16095938[4]

ΔargC::kan

deletion

Biolog:respiration

unable to respire L-Alanine

PMID:16095938[4]

ΔargC::kan

deletion

Biolog:respiration

unable to respire L-Alanyl-glycine

PMID:16095938[4]

ΔargC::kan

deletion

Biolog:respiration

unable to respire L-Asparagine

PMID:16095938[4]

ΔargC::kan

deletion

Biolog:respiration

unable to respire L-Aspartate

PMID:16095938[4]

argC32

Auxotrophies

CGSC:5730

argC24

Auxotrophies

CGSC:5985

ΔargC745::kan

deletion

deletion

Auxotrophies

PMID:16738554[2]

CGSC:100040


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW3930

Plasmid clone

Shigen

PMID:16769691[5]

Status:Clone OK

Primer 1:GCCTTGAATACGCTGATTGTGGG

Primer 2:CCAATAAGAGACTGCGTTTCCGC

4G11

Kohara Phage

Genobase

PMID:3038334[6]

8H10

Kohara Phage

Genobase

PMID:3038334[6]

argE86::Tn10

Linked marker

CAG12185 = CGSC7471[3]

est. P1 cotransduction: 98% [7]

thiC39::Tn10

Linked marker

CAG18500 = CGSC7472[3]

est. P1 cotransduction: 17% [7]
Synonyms:thi-39::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10065

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10065

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000061

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:948455

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0063

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0012964

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  3. 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
  4. 4.00 4.01 4.02 4.03 4.04 4.05 4.06 4.07 4.08 4.09 4.10 4.11 4.12 4.13 4.14 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed EcoliWiki page
  5. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  6. 6.0 6.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  7. 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories