PortEco logo

argD:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

argD

Mnemonic

Arginine

Synonyms

ECK3347, b3359, JW3322, Arg1, dapC, dtu[1], alaB, argG, dtu

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

75.16 minutes 

MG1655: 3488202..3486982


REL606

NC_012967: 3418085..3416865


BW2952

NC_012759: 3374139..3375359


W3110

 

W3110: 4150236..4151456


DH10B

DH10B: 3585947..3584727


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

3486985

Edman degradation

PMID:9298646[2]
PMID:10074354[3]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔargD (Keio:JW3322)

deletion

deletion

Auxotrophies

PMID:16738554[4]

Shigen

CGSC10482[5]

argD::Tn5KAN-I-SceI (FB21129)

Insertion at nt 429 in Plus orientation

Auxotrophies

PMID:15262929[6]

E. coli Genome Project:FB21129

does not contain pKD46

argD::Tn5KAN-I-SceI (FB21130)

Insertion at nt 429 in Plus orientation

Auxotrophies

PMID:15262929[6]

E. coli Genome Project:FB21130

contains pKD46

argD37

Auxotrophies

PMID:4872548[7]

CGSC:5152

argD85

Auxotrophies

CGSC:5201

ΔargD767::kan

deletion

deletion

Auxotrophies

PMID:16738554[4]

CGSC:100042

argD767(del)::FRTKanFRT

Mutagenesis rate

Decreased stress-induced mutagenesis (SIM) phenotype.

PMID:23224554[8]

Parental Strain: SMR4562

Experimental Strain: SMR12005

Mutation was comparatively weak with decrease only happening to 33-67% of population.

Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW3322

Plasmid clone

Shigen

PMID:16769691[9]

Status:Clone OK

Primer 1:GCCGCAATTGAACAAACAGCAAT

Primer 2:CCgGCCCCAACCACCTTCGCCAC

15C3

Kohara Phage

Genobase

PMID:3038334[10]

4C5

Kohara Phage

Genobase

PMID:3038334[10]

smg-3082::Tn10

Linked marker

CAG12071 = CGSC7444[5]

est. P1 cotransduction: 5% [11]
Synonyms:zhb-3082::Tn10, zhd-3082::Tn10

zhf-3084::Tn10

Linked marker

CAG18456 = CGSC7576[5]

est. P1 cotransduction: 57% [11]
Synonyms:zhe-3084::Tn10nnnCAG18456 also carries cysG0 (CGSC).

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10066

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10066

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000062

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:947864

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0064

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0010976

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed EcoliWiki page
  3. Ledwidge, R & Blanchard, JS (1999) The dual biosynthetic capability of N-acetylornithine aminotransferase in arginine and lysine biosynthesis. Biochemistry 38 3019-24 PubMed EcoliWiki page
  4. 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  7. Itikawa, H et al. (1968) Enzymic basis for a genetic suppression: accumulation and deacylation of N-acetylglutamic gamma-semialdehyde in enterobacterial mutants. Biochim. Biophys. Acta 159 547-50 PubMed EcoliWiki page
  8. Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed EcoliWiki page
  9. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  10. 10.0 10.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  11. 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories