PortEco logo

argE:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

argE

Mnemonic

Arginine

Synonyms

ECK3948, b3957, JW3929, Arg4[1], Arg4, argA

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

89.48 minutes 

MG1655: 4152870..4151719


REL606

NC_012967: 4134708..4133557


BW2952

NC_012759: 4041388..4042539


W3110

 

W3110: 3481834..3482985


DH10B

DH10B: 4252567..4251416


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔargE (Keio:JW3929)

deletion

deletion

Auxotrophies

PMID:16738554[2]

Shigen

CGSC10838[3]

argE86::Tn10

Insertion at 4,152,178 bp in MG1655 (NC_000913)

Auxotrophies

adapted from Nichols et al.[4]

CAG12185 = CGSC7471[3]

Synonyms:

argE3(Oc)

Auxotrophies

PMID:340898[5]

CGSC:4514

ochre (UAA) mutation

argE54

Auxotrophies

CGSC:5169

argE86::Tn10

Auxotrophies

PMID:3540312[6]

CGSC:7385

argE25

Auxotrophies

CGSC:8924

ΔargE744::kan

deletion

deletion

Auxotrophies

PMID:16738554[2]

CGSC:100044


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW3929

Plasmid clone

Shigen

PMID:16769691[7]

Status:Clone OK

Primer 1:GCCAAAAACAAATTACCGCCATT

Primer 2:CCATGCCAGCAAAAATGGTGAAT

4G11

Kohara Phage

Genobase

PMID:3038334[8]

8H10

Kohara Phage

Genobase

PMID:3038334[8]

pflD501::Tn10

Linked marker

CAG18477 = CGSC7470[3]

est. P1 cotransduction: 75% [4]
Synonyms:zij-501::Tn10 nnnCAG18477 also carries metF79(Am) (CGSC).

thiC39::Tn10

Linked marker

CAG18500 = CGSC7472[3]

est. P1 cotransduction: 16% [4]
Synonyms:thi-39::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11286

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11286

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001259

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:948456

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1263

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0012955

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  3. 3.0 3.1 3.2 3.3 CGSC: The Coli Genetics Stock Center
  4. 4.0 4.1 4.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  5. Kato, T & Shinoura, Y (1977) Isolation and characterization of mutants of Escherichia coli deficient in induction of mutations by ultraviolet light. Mol. Gen. Genet. 156 121-31 PubMed EcoliWiki page
  6. Wanner, BL (1986) Novel regulatory mutants of the phosphate regulon in Escherichia coli K-12. J. Mol. Biol. 191 39-58 PubMed EcoliWiki page
  7. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  8. 8.0 8.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page

Categories