PortEco logo

argG:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

argG

Mnemonic

Arginine

Synonyms

ECK3161, b3172, JW3140, Arg6[1], Arg6, argE

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

71.48 minutes 

MG1655: 3316659..3318002


REL606

NC_012967: 3253871..3255214


BW2952

NC_012759: 3203807..3205150


W3110

 

W3110: 3318492..3319835


DH10B

DH10B: 3414404..3415747


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

3316662

Edman degradation

PMID:2123815[2]
PMID:9298646[3]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔargG (Keio:JW3140)

deletion

deletion

Auxotrophies

PMID:16738554[4]

Shigen

CGSC8306[5]

argG::Tn5KAN-I-SceI (FB21055)

Insertion at nt 895 in Minus orientation

Auxotrophies

PMID:15262929[6]

E. coli Genome Project:FB21055

contains pKD46

argG::Tn5KAN-I-SceI (FB21056)

Insertion at nt 895 in Minus orientation

Auxotrophies

PMID:15262929[6]

E. coli Genome Project:FB21056

does not contain pKD46

argG6

Auxotrophies

CGSC:4887

argG34

Auxotrophies

CGSC:5148

argG35

Auxotrophies

CGSC:5150

argG53

Auxotrophies

CGSC:5168

argG66

Auxotrophies

CGSC:5182

argG75

Auxotrophies

CGSC:5191

argG77

Auxotrophies

CGSC:5193

argG78

Auxotrophies

CGSC:5194

argG83

Auxotrophies

CGSC:5199

ΔargG781::kan

deletion

deletion

Auxotrophies

PMID:16738554[4]

CGSC:99800


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW3140

Plasmid clone

Shigen

PMID:16769691[7]

Status:Clone OK

Primer 1:GCCACGACGATTCTCAAGCATCT

Primer 2:CCtTGGCCTTTGTTTTCCAGATT

E4G11S

Kohara Phage

Genobase

PMID:3038334[8]

18H7

Kohara Phage

Genobase

PMID:3038334[8]

aer-3075::Tn10

Linked marker

CAG12152 = CGSC7438[5]

est. P1 cotransduction: % [9]
Synonyms:zgh-3075::Tn10, zgj-3075::Tn10

sfsB203::Tn10

Linked marker

CAG12072 = CGSC7440[5]

est. P1 cotransduction: 60% [9]
Synonyms:zgj-203::Tn10, zha-203::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10068

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10068

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000064

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:947590

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0066

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0010428

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Van Vliet, F et al. (1990) Sequences of the genes encoding argininosuccinate synthetase in Escherichia coli and Saccharomyces cerevisiae: comparison with methanogenic archaebacteria and mammals. Gene 95 99-104 PubMed EcoliWiki page
  3. Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed EcoliWiki page
  4. 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  7. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  8. 8.0 8.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  9. 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories