PortEco logo

argI:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

argI

Mnemonic

Arginine

Synonyms

ECK4247, b4254, JW4211[1], JW4211

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

96.46 minutes 

MG1655: 4476334..4475330


REL606

NC_012967: 4461443..4460439


BW2952

NC_012759: 4414065..4415069


W3110

 

W3110: 4482991..4481987


DH10B

DH10B: 4578142..4577138


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

4475333

Edman degradation

PMID:9298646[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔargI (Keio:JW4211)

deletion

deletion

Auxotrophies

PMID:16738554[3]

Shigen

CGSC11031[4]

argI44

Auxotrophies

CGSC:5159

argI60

Auxotrophies

CGSC:5176

argI61

Auxotrophies

CGSC:5177

argI67

Auxotrophies

CGSC:5183

ΔargI68

deletion

deletion

Auxotrophies

CGSC:5184

ΔargI74

deletion

deletion

Auxotrophies

CGSC:5190

argI82

Auxotrophies

CGSC:5198

argI140(Am)

Auxotrophies

PMID:4942757[5]

CGSC:5208

amber (UAG) mutation

ΔargI728::kan

deletion

deletion

Auxotrophies

PMID:16738554[3]

CGSC:100048


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW4211

Plasmid clone

Shigen

PMID:16769691[6]

Status:Clone OK

Primer 1:GCCTCCGGGTTTTATCATAAGCA

Primer 2:CCTTTACTGAGCGTCGCGACCAT

E1F5

Kohara Phage

Genobase

PMID:3038334[7]

5C4

Kohara Phage

Genobase

PMID:3038334[7]

zjf-920::Tn10

Linked marker

CAG12019 = CGSC7484[4]

est. P1 cotransduction: 30% [8]
Synonyms:zjh-901::Tn10, zjg-920::Tn10

mdoB202::Tn10

Linked marker

CAG18430 = CGSC7488[4]

est. P1 cotransduction: % [8]
Synonyms:zjj-202::Tn10, zji-202::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10069

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10069

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000065

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:948774

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0067

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0013927

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed EcoliWiki page
  3. 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. Jacoby, GA (1971) Mapping the gene determining ornithine transcarbamylase and its operator in Escherichia coli B. J. Bacteriol. 108 645-51 PubMed EcoliWiki page
  6. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  7. 7.0 7.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  8. 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories