PortEco logo

argR:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

argR

Mnemonic

Arginine

Synonyms

ECK3226, b3237, JW3206, xerA, Rarg[1], Rarg

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

72.91 minutes 

MG1655: 3382725..3383195


REL606

NC_012967: 3312600..3313070


BW2952

NC_012759: 3269873..3270343


W3110

 

W3110: 3384558..3385028


DH10B

DH10B: 3480470..3480940


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

3382725

Edman degradation

PMID:3116542[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

argRG123D

G123D

Auxotrophies

Defective binding to arginine and to ARG box. Forms dimers not hexamers

seeded from UniProt:P0A6D0

argRS44F

S44F

Auxotrophies

Defective binding to ARG box

seeded from UniProt:P0A6D0

argRS47L

S47L

Auxotrophies

Defective binding to ARG box

seeded from UniProt:P0A6D0

argRP76L

P76L

Auxotrophies

Increased affinity for ARG box in the absence of arginine

seeded from UniProt:P0A6D0

argRA105V

A105V

Auxotrophies

Defective binding to arginine and to ARG box

seeded from UniProt:P0A6D0

argRE21K

E21K

Auxotrophies

Increased affinity for ARG box in the presence of arginine

seeded from UniProt:P0A6D0

ΔargR (Keio:JW3206)

deletion

deletion

Auxotrophies

PMID:16738554[3]

Shigen CGSC10431[4]

argR::Tn5KAN-I-SceI (FB21082)

Insertion at nt 118 in Minus orientation

Auxotrophies

PMID:15262929[5]

E. coli Genome Project:FB21082

contains pKD46

ΔargR::kan

deletion

deletion

Biolog:respiration

unable to respire L-Aspartate

PMID:16095938[6]

argR38

Auxotrophies

CGSC:5153

argR40

Auxotrophies

CGSC:5155

argR63

Auxotrophies

CGSC:5179

argR64

Auxotrophies

CGSC:5180

argR84

Auxotrophies

CGSC:5200

[argR141]

Auxotrophies

CGSC:5209

null allele

argR142

Auxotrophies

CGSC:5210

ΔargR762::kan

deletion

deletion

Auxotrophies

PMID:16738554[3]

CGSC:100054


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW3206

Plasmid clone

Shigen

PMID:16769691[7]

Status:Clone OK

Primer 1:GCCCGAAGCTCGGCTAAGCAAGA

Primer 2:CCAAGCTCCTGGTCGAACAGCTC

1E3

Kohara Phage

Genobase

PMID:3038334[8]

3G9

Kohara Phage

Genobase

PMID:3038334[8]

zhc-6::Tn10

Linked marker

CAG12153 = CGSC7442[4]

est. P1 cotransduction: 50% [9]
Synonyms:zha-6::Tn10

acrF3083::Tn10

Linked marker

CAG12075 = CGSC7447[4]

est. P1 cotransduction: 28% [9]
Synonyms:zhd-3083::Tn10, zhe-3083::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10070

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10070

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000066

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:947861

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0068

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0010620

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Lim, DB et al. (1987) Nucleotide sequence of the argR gene of Escherichia coli K-12 and isolation of its product, the arginine repressor. Proc. Natl. Acad. Sci. U.S.A. 84 6697-701 PubMed EcoliWiki page
  3. 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  6. Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed EcoliWiki page
  7. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  8. 8.0 8.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  9. 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories