PortEco logo

argS:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

argS

Mnemonic

Arginine

Synonyms

ECK1877, b1876, JW1865, lov[1], lov

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

42.2 minutes, 42.2 minutes 

MG1655: 1958086..1959819


REL606

NC_012967: 1938832..1940565


BW2952

NC_012759: 1850145..1851878


W3110

 

W3110: 1961776..1963509


DH10B

DH10B: 2048657..2050390


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

1958086

Edman degradation

PMID:2668891[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

argS41

Auxotrophies

CGSC:5156

lov

Resistant to

Resistance to Mecillinam

PMID:2847279[3]

Strain: GC2702

Parental: GC2700

See figure 1. Synonym is argS

lov-1

Resistant to

Resistance to Mecillinam

PMID:2540960[4]

Strain: GC2702

Parental: GC2700

Synonym is argS 

lov-1

Resistant to

Resistance to Mecillinam

PMID:2540960[4]

Strain: GC2702

Parental: GC2700

Synonym is argS 

argS201

Resistant to

Resistance to Mecillinam

PMID:1563353[5]

Strain: GC3700

Results on Table 2

Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW1865

Plasmid clone

Shigen

PMID:16769691[6]

Status:Clone OK

Primer 1:GCCAATATTCAGGCTCTTCTCTC

Primer 2:CCCATACGCTCTACAGTCTCAAT

20H4

Kohara Phage

Genobase

PMID:3038334[7]

12C7

Kohara Phage

Genobase

PMID:3038334[7]

eda-51::Tn10

Linked marker

CAG18486 = CGSC7392[8]

est. P1 cotransduction: 34% [9]

uvrC279::Tn10

Linked marker

CAG12156 = CGSC7394[8]

est. P1 cotransduction: 28% [9]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10071

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10071

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000067

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:946452

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0069

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0006264

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Eriani, G et al. (1989) Isolation and characterization of the gene coding for Escherichia coli arginyl-tRNA synthetase. Nucleic Acids Res. 17 5725-36 PubMed EcoliWiki page
  3. Bouloc, P et al. () Preliminary physiologic characterization and genetic analysis of a new Escherichia coli mutant, lov, resistant to mecillinam. Rev. Infect. Dis. 10 905-10 PubMed EcoliWiki page
  4. 4.0 4.1 Bouloc, P et al. (1989) The Escherichia coli lov gene product connects peptidoglycan synthesis, ribosomes and growth rate. EMBO J. 8 317-23 PubMed EcoliWiki page
  5. Vinella, D et al. (1992) Penicillin binding protein 2 is dispensable in Escherichia coli when ppGpp synthesis is induced. EMBO J. 11 1493-501 PubMed EcoliWiki page
  6. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  7. 7.0 7.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  8. 8.0 8.1 CGSC: The Coli Genetics Stock Center
  9. 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories