PortEco logo

argT:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

argT

Mnemonic

Arginine

Synonyms

ECK2304, b2310, JW2307, G388, G7989[1][2]

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

52.27 minutes 

MG1655: 2425813..2425031


REL606

NC_012967: 2371383..2370601


BW2952

NC_012759: 2310836..2311618


W3110

 

W3110: 2433237..2432455


DH10B

DH10B: 2517578..2516796


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

2425034

Edman degradation

PMID:3040734[3]
PMID:9298646[4]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔargT (Keio:JW2307)

deletion

deletion

Auxotrophies

PMID:16738554[5]

Shigen

argT::Tn5KAN-2 (FB20757)

Insertion at nt 661 in Minus orientation

Auxotrophies

PMID:15262929[6]

E. coli Genome Project:FB20757

contains pKD46

Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2307

Plasmid clone

Shigen

PMID:16769691[7]

Status:Clone OK

Primer 1:GCCAAGAAGTCGATTCTCGCTCT

Primer 2:CCGTCACCGTAGACATTAAAGTC

9D2

Kohara Phage

Genobase

PMID:3038334[8]

zfb-223::Tn10

Linked marker

CAG18484 = CGSC7406[9]

est. P1 cotransduction: 23% [10]
Synonyms:zej-223::Tn10

zfd-1::Tn10

Linked marker

CAG18467 = CGSC7408[9]

est. P1 cotransduction: 2% [10]
Synonyms:zfb-1::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10072

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10072

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000068

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:949030

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0070

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0007621

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. Nonet, ML et al. (1987) The hisT-purF region of the Escherichia coli K-12 chromosome. Identification of additional genes of the hisT and purF operons. J. Biol. Chem. 262 12209-17 PubMed EcoliWiki page
  4. Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed EcoliWiki page
  5. Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  6. Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  7. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  8. Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  9. 9.0 9.1 CGSC: The Coli Genetics Stock Center
  10. 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories