PortEco logo

arnD:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

arnD

Mnemonic

ara4N (4-amino-4-deoxy-L-arabinose)

Synonyms

ECK2249, b2256, JW2250, pmrJ, yfbH[1][2], pbgP4, pmrJ, yfbH

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

51.04 minutes 

MG1655: 2368040..2368930


REL606

NC_012967: 2316531..2317421


BW2952

NC_012759: 2253845..2254735


W3110

 

W3110: 2374688..2375578


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔyfbH (Keio:JW2250)

deletion

deletion

PMID:16738554[3]

Shigen
CGSC9814[4]

ΔyfbH737::kan

PMID:16738554[3]

CGSC:104642


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2250

Plasmid clone

Shigen

PMID:16769691[5]

Status:Clone OK

Primer 1:GCCACCAAAGTAGGCTTACGCAT

Primer 2:CCGCGACTACCCGCAATTTGTTG

zfa-723::Tn10

Linked marker

CAG12178 gyrA+ = CGSC7526[4]

est. P1 cotransduction: 39% [6]
Synonyms:zei-723::Tn10, zfa-723::Tn10 nnnThe original CAG12178 was NalR. This is a NalS derivative constructed by S. McAteer (CGSC).

zfb-223::Tn10

Linked marker

CAG18484 = CGSC7406[4]

est. P1 cotransduction: 46% [6]
Synonyms:zej-223::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G7169

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG14092

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003745

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945334

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB3845

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0007462

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories