PortEco logo

aroC:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

aroC

Mnemonic

Aromatic

Synonyms

ECK2323, b2329, JW2326[1], JW2326

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

52.68 minutes 

MG1655: 2445495..2444410


REL606

NC_012967: 2391065..2389980


BW2952

NC_012759: 2330215..2331300


W3110

 

W3110: 2452919..2451834


DH10B

DH10B: 2537260..2536175


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

2444413

Edman degradation

PMID:2969724[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

aroC(del) (Keio:JW2326)

deletion

deletion

PMID:16738554[3]

Shigen
CGSC9865[4]

aroC::Tn5KAN-2 (FB20766)

Insertion at nt 619 in Plus orientation

PMID:15262929[5]

E. coli Genome Project:FB20766

contains pKD46

aroC::Tn5KAN-2 (FB20767)

Insertion at nt 619 in Plus orientation

PMID:15262929[5]

E. coli Genome Project:FB20767

does not contain pKD46

aroC4

CGSC:6010

aroC355

CGSC:8228

aroC1

PMID:5326114[6] PMID:14221874[7]

CGSC:13158

aroC8

CGSC:17181

aroC737(del)::kan

PMID:16738554[3]

CGSC:100062


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2326

Plasmid clone

Shigen

PMID:16769691[8]

Status:Clone OK

Primer 1:GCCGCTGGAAACACAATTGGACA

Primer 2:CCCCAGCGTGGAATATCAGTCTT

12F12

Kohara Phage

Genobase

PMID:3038334[9]

2G11

Kohara Phage

Genobase

PMID:3038334[9]

2C9

Kohara Phage

Genobase

PMID:3038334[9]

zfb-223::Tn10

Linked marker

CAG18484 = CGSC7406[4]

est. P1 cotransduction: 7% [10]
Synonyms:zej-223::Tn10

zfd-1::Tn10

Linked marker

CAG18467 = CGSC7408[4]

est. P1 cotransduction: 12% [10]
Synonyms:zfb-1::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10075

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10075

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000071

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:946814

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0073

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0007693

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. White, PJ et al. (1988) The overexpression, purification and complete amino acid sequence of chorismate synthase from Escherichia coli K12 and its comparison with the enzyme from Neurospora crassa. Biochem. J. 251 313-22 PubMed EcoliWiki page
  3. 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. 5.0 5.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  6. Pittard, J & Wallace, BJ (1966) Distribution and function of genes concerned with aromatic biosynthesis in Escherichia coli. J. Bacteriol. 91 1494-508 PubMed EcoliWiki page
  7. TAYLOR, AL & THOMAN, MS (1964) THE GENETIC MAP OF ESCHERICHIA COLI K-12. Genetics 50 659-77 PubMed EcoliWiki page
  8. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  9. 9.0 9.1 9.2 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  10. 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories