PortEco logo

aroE:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

aroE

Mnemonic

Aromatic

Synonyms

ECK3268, b3281, JW3242[1], JW3242

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

73.89 minutes, 73.89 minutes 

MG1655: 3428860..3428042


REL606

NC_012967: 3358743..3357925


BW2952

NC_012759: 3315199..3316017


W3110

 

W3110: 4209578..4210396


DH10B

DH10B: 3526605..3525787


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

3428042

Edman degradation

PMID:3277621[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

aroE(del) (Keio:JW3242)

deletion

deletion

PMID:16738554[3]

Shigen
CGSC8307[4]

aroE24

CGSC:6187

aroE353

CGSC:7564

aroE721(del)::kan

PMID:16738554[3]

CGSC:99781


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW3242

Plasmid clone

Shigen

PMID:16769691[5]

Status:Clone OK

Primer 1:GCCGAAACCTATGCTGTTTTTGG

Primer 2:CCgGCGGACAATTCCTCCTGCAA

acrF3083::Tn10

Linked marker

CAG12075 = CGSC7447[4]

est. P1 cotransduction: 63% [6]
Synonyms:zhd-3083::Tn10, zhe-3083::Tn10

smg-3082::Tn10

Linked marker

CAG12071 = CGSC7444[4]

est. P1 cotransduction: 98% [6]
Synonyms:zhb-3082::Tn10, zhd-3082::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10077

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10077

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000073

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:947776

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0075

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0010763

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Anton, IA & Coggins, JR (1988) Sequencing and overexpression of the Escherichia coli aroE gene encoding shikimate dehydrogenase. Biochem. J. 249 319-26 PubMed EcoliWiki page
  3. 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories