PortEco logo

aroF:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

aroF

Mnemonic

Aromatic

Synonyms

ECK2598, b2601, JW2582[1], JW2582

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

59.01 minutes 

MG1655: 2739172..2738102


REL606

NC_012967: 2662557..2661487


BW2952

NC_012759: 2623914..2624984


W3110

 

W3110: 2739806..2738736


DH10B

DH10B: 2830937..2829867


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

2738102

Edman degradation

PMID:6104668[2]
PMID:6146618[3]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔaroF (Keio:JW2582)

deletion

deletion

PMID:16738554[4]

Shigen
CGSC10050[5]

aroF::Tn5KAN-I-SceI (FB20866)

Insertion at nt 345 in Plus orientation

PMID:15262929[6]

E. coli Genome Project:FB20866

contains pKD46

aroF363

CGSC:11301

ΔaroF764::kan

PMID:16738554[4]

CGSC:100066


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2582

Plasmid clone

Shigen

PMID:16769691[7]

Status:Clone OK

Primer 1:GCCCAAAAAGACGCGCTGAATAA

Primer 2:CCAGCCACGCGAGCCGTCAGCTG

E8F2

Kohara Phage

Genobase

PMID:3038334[8]

pheA18::Tn10

Linked marker

CAG12158 = CGSC7421[5]

est. P1 cotransduction: 98% [9]

srlD3131::Tn10

Linked marker

CAG18642 = CGSC7423[5]

est. P1 cotransduction: % [9]
Synonyms:zfh-3131::Tn10, zfi-3131::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10078

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10078

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000074

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:947084

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0076

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0008549

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Herrmann, KM et al. (1980) Sequence homology between the tyrosine-sensitive 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase from Escherichia coli and hemerythrin from Sipunculida. J. Biol. Chem. 255 7079-81 PubMed EcoliWiki page
  3. Shultz, J et al. (1984) The nucleotide sequence of the aroF gene of Escherichia coli and the amino acid sequence of the encoded protein, the tyrosine-sensitive 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase. J. Biol. Chem. 259 9655-61 PubMed EcoliWiki page
  4. 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  7. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  8. Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  9. 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories