PortEco logo

aroG:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

aroG

Mnemonic

Aromatic

Synonyms

ECK0743, b0754, JW0737[1], JW0737

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

16.92 minutes 

MG1655: 784856..785908


REL606

NC_012967: 766262..767314


BW2952

NC_012759: 687824..688876


W3110

 

W3110: 786055..787107


DH10B

DH10B: 837448..838500


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

784856

Edman degradation

PMID:9298646[2]
PMID:9740056[3]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔaroG (Keio:JW0737)

deletion

deletion

PMID:16738554[4]

Shigen
CGSC8801[5]

aroG365

CGSC:11321

ΔaroG726::kan

PMID:16738554[4]

CGSC:100068


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0737

Plasmid clone

Shigen

PMID:16769691[6]

Status:Clone OK

Primer 1:GCCAATTATCAGAACGACGATTT

Primer 2:CCCCCGCGACGCGCTTTTACTGC

4H1

Kohara Phage

Genobase

PMID:3038334[7]

nadA57::Tn10

Linked marker

CAG12147 = CGSC7351[5]

est. P1 cotransduction: 84% [8]

zbh-29::Tn10

Linked marker

CAG18493 = CGSC7353[5]

est. P1 cotransduction: 22% [8]
Synonyms:zbi-29::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10079

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10079

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000075

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945605

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0077

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0002560

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed EcoliWiki page
  3. Tonella, L et al. (1998) '98 Escherichia coli SWISS-2DPAGE database update. Electrophoresis 19 1960-71 PubMed EcoliWiki page
  4. 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  7. Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  8. 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories