PortEco logo

aroH:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

aroH

Mnemonic

Aromatic

Synonyms

ECK1702, b1704, JW1694[1], JW1694

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

38.5 minutes 

MG1655: 1786459..1787505


REL606

NC_012967: 1765703..1766749


BW2952

NC_012759: 1678518..1679564


W3110

 

W3110: 1790149..1791195


DH10B

DH10B: 1877030..1878076


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

1786459

Edman degradation

PMID:6167722[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔaroH (Keio:JW1694)

deletion

deletion

PMID:16738554[3]

Shigen
CGSC9433[4]

aroH::Tn5KAN-2 (FB20433)

Insertion at nt 215 in Minus orientation

PMID:15262929[5]

E. coli Genome Project:FB20433

contains pKD46

aroH::Tn5KAN-2 (FB20434)

Insertion at nt 215 in Minus orientation

PMID:15262929[5]

E. coli Genome Project:FB20434

does not contain pKD46

aroH367

CGSC:5310

ΔaroH778::kan

PMID:16738554[3]

CGSC:100070


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW1694

Plasmid clone

Shigen

PMID:16769691[6]

Status:Clone OK

Primer 1:GCCAACAGAACTGACGAACTCCG

Primer 2:CCGAAGCGGGTATCTACCGCAGA

20F5

Kohara Phage

Genobase

PMID:3038334[7]

zdi-925::Tn10

Linked marker

CAG12151 = CGSC7385[4]

est. P1 cotransduction: 72% [8]
Synonyms:zdh-925::Tn10

zdj-276::Tn10

Linked marker

CAG18464 = CGSC7387[4]

est. P1 cotransduction: 13% [8]
Synonyms:zdi-276::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10080

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10080

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000076

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:946229

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0078

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0005686

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Zurawski, G et al. (1981) Structure and regulation of aroH, the structural gene for the tryptophan-repressible 3-deoxy-D-arabino-heptulosonic acid-7-phosphate synthetase of Escherichia coli. J. Mol. Biol. 145 47-73 PubMed EcoliWiki page
  3. 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. 5.0 5.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  6. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  7. Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  8. 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories