PortEco logo

aroL:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

aroL

Mnemonic

Aromatic

Synonyms

ECK0383, b0388, JW0379[1], JW0379

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

8.74 minutes 

MG1655: 405629..406153


REL606

NC_012967: 374051..374575


BW2952

NC_012759: 308388..308912


W3110

 

W3110: 405629..406153


DH10B

DH10B: 344960..345484


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

405632

Edman degradation

PMID:3001029[2]
PMID:3026317[3]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

aroL(del) (Keio:JW0379)

deletion

deletion

PMID:16738554[4]

Shigen

CGSC8556[5]

aroL476

CGSC:12249

aroL478::Tn10

CGSC:12253

aroL753(del)::kan

PMID:16738554[4]

CGSC:100072


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0379

Plasmid clone

Shigen

PMID:16769691[6]

Status:Clone OK

Primer 1:GCCACACAACCTCTTTTTCTGAT

Primer 2:CCACAATTGATCGTCTGTGCCAG

1A10

Kohara Phage

Genobase

PMID:3038334[7]

6A12

Kohara Phage

Genobase

PMID:3038334[7]

zai-3053::Tn10

Linked marker

CAG18091 = CGSC7336[5]

est. P1 cotransduction: 68% [8]
Synonyms:zaj-3053::Tn10 nnnCAG18091 also carries proC9999 (CGSC).

tsx-247::Tn10

Linked marker

CAG12148 = CGSC7337[5]

est. P1 cotransduction: 38% [8]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10082

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10082

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000078

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945031

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0080

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0001353

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. DeFeyter, RC & Pittard, J (1986) Purification and properties of shikimate kinase II from Escherichia coli K-12. J. Bacteriol. 165 331-3 PubMed EcoliWiki page
  3. Millar, G et al. (1986) The cloning and expression of the aroL gene from Escherichia coli K12. Purification and complete amino acid sequence of shikimate kinase II, the aroL-gene product. Biochem. J. 237 427-37 PubMed EcoliWiki page
  4. 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  7. 7.0 7.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  8. 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories