PortEco logo

arsB:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

arsB

Mnemonic

Arsenate resistance

Synonyms

ECK3487, b3502, JW3469, arsF, f172[1][2]

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

78.6 minutes 

MG1655: 3646958..3648247


REL606

NC_012967: 3579625..3580914


BW2952

NC_012759: 3535452..3536741


W3110

 

W3110: 3991480..3990191


DH10B

DH10B: 3744703..3745992


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔarsB (Keio:JW3469)

deletion

deletion

PMID:16738554[3]

Shigen
CGSC10571[4]

arsB::Tn5KAN-I-SceI (FB21246)

Insertion at nt 267 in Plus orientation

PMID:15262929[5]

E. coli Genome Project:FB21246

contains pKD46

ΔarsB758::kan

PMID:16738554[3]

CGSC:100082


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW3469

Plasmid clone

Shigen

PMID:16769691[6]

Status:Clone OK

Primer 1:GCCTTACTGGCAGGCGCTATCTT

Primer 2:CCtAAAGTGAAAGAGAGACGTAG

4D9

Kohara Phage

Genobase

PMID:3038334[7]

12E4

Kohara Phage

Genobase

PMID:3038334[7]

zhg-50::Tn10

Linked marker

CAG18450 = CGSC7450[4]

est. P1 cotransduction: 6% [8]
Synonyms:zhf-50::Tn10, zhf-5::Tn10

zic-4901::Tn10

Linked marker

CAG18492 = CGSC7457[4]

est. P1 cotransduction: % [8]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG12236

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG12236

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002120

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:948011

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2148

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0011437

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  6. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  7. 7.0 7.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  8. 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories