PortEco logo

artJ:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

artJ

Mnemonic

Arginine transport

Synonyms

ECK0851, b0860, JW0844[1], JW0844

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

19.38 minutes 

MG1655: 899798..899067


REL606

NC_012967: 917282..916551


BW2952

NC_012759: 802035..802766


W3110

 

W3110: 900997..900266


DH10B

DH10B: 953726..952995


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

899070

Edman degradation

PMID:8801422[2]
PMID:9298646[3]
PMID:9600841[4]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔartJ (Keio:JW0844)

deletion

deletion

PMID:16738554[5]

Shigen
CGSC8880[6]

ΔartJ761::kan

PMID:16738554[5]

CGSC:100090


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0844

Plasmid clone

Shigen

PMID:16769691[7]

Status:Clone OK

Primer 1:GCCAAAAAGTTAGTTCTTGCCGC

Primer 2:CCCTGTGGGAACCACTGGTCACT

14H6

Kohara Phage

Genobase

PMID:3038334[8]

zbh-29::Tn10

Linked marker

CAG18493 = CGSC7353[6]

est. P1 cotransduction: % [9]
Synonyms:zbi-29::Tn10

zca-1230::Tn10

Linked marker

CAG18478 = CGSC7356[6]

est. P1 cotransduction: 12% [9]
Synonyms:zbj-1230::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11628

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11628

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001576

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:948981

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1585

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0002927

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Wissenbach, U et al. (1995) A third periplasmic transport system for L-arginine in Escherichia coli: molecular characterization of the artPIQMJ genes, arginine binding and transport. Mol. Microbiol. 17 675-86 PubMed EcoliWiki page
  3. Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed EcoliWiki page
  4. Wilkins, MR et al. (1998) Protein identification with N and C-terminal sequence tags in proteome projects. J. Mol. Biol. 278 599-608 PubMed EcoliWiki page
  5. 5.0 5.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  6. 6.0 6.1 6.2 CGSC: The Coli Genetics Stock Center
  7. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  8. Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  9. 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories