PortEco logo

asmA:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

asmA

Mnemonic

Assembly suppressor mutant

Synonyms

ECK2058, b2064, JW2049, yegA[1], yegA

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

46.08 minutes 

MG1655: 2139636..2137783


REL606

NC_012967: 2074818..2072965


BW2952

NC_012759: 2030266..2032119


W3110

 

W3110: 2143749..2141896


DH10B

DH10B: 2230644..2228791


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔasmA (Keio:JW2049)

deletion

deletion

PMID:16738554[2]

Shigen
CGSC9683[3]

asmA::Tn5KAN-I-SceI (FB20602)

Insertion at nt 1238 in Minus orientation

PMID:15262929[4]

E. coli Genome Project:FB20602

contains pKD46

ΔasmA762::kan

PMID:16738554[2]

CGSC:100102


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2049

Plasmid clone

Shigen

PMID:16769691[5]

Status:Clone OK

Primer 1:GCCAGACGATTTCTGACGACGCT

Primer 2:CCCATCTTCTCCAGCAACTTCTT

2E1

Kohara Phage

Genobase

PMID:3038334[6]

3G4

Kohara Phage

Genobase

PMID:3038334[6]

zef-3129::Tn10

Linked marker

CAG12099 = CGSC7397[3]

est. P1 cotransduction: 7% [7]
Synonyms:zee-3129::Tn10

zbd-3104::Tn10

Linked marker

CAG12021 = CGSC7344[3]

est. P1 cotransduction: 20% [7]
Synonyms:zbc-3105::Tn10, zbd-3105::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11361

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11361

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001330

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:946582

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1336

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0006833

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  3. 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
  4. Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  5. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  6. 6.0 6.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  7. 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories